ID: 1122046070

View in Genome Browser
Species Human (GRCh38)
Location 14:99024937-99024959
Sequence GAGAATGTGCAATGCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122046064_1122046070 14 Left 1122046064 14:99024900-99024922 CCATGAGAATCAGCAAACCTTAT No data
Right 1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG No data
1122046065_1122046070 -3 Left 1122046065 14:99024917-99024939 CCTTATTTTAGCCCAATATAGAG No data
Right 1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122046070 Original CRISPR GAGAATGTGCAATGCATGGA GGG Intergenic
No off target data available for this crispr