ID: 1122047769

View in Genome Browser
Species Human (GRCh38)
Location 14:99035834-99035856
Sequence TTGCAGAAGGAGAAGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122047759_1122047769 20 Left 1122047759 14:99035791-99035813 CCAATGTGAGCAAACGGAGGCTC No data
Right 1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG No data
1122047756_1122047769 26 Left 1122047756 14:99035785-99035807 CCATTTCCAATGTGAGCAAACGG No data
Right 1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG No data
1122047761_1122047769 -9 Left 1122047761 14:99035820-99035842 CCGTGTTCCCAAGGTTGCAGAAG No data
Right 1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122047769 Original CRISPR TTGCAGAAGGAGAAGGGGCC GGG Intergenic
No off target data available for this crispr