ID: 1122048140

View in Genome Browser
Species Human (GRCh38)
Location 14:99037957-99037979
Sequence AGCCTCAGATGGTCCCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122048140_1122048153 26 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG No data
1122048140_1122048146 1 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048140_1122048152 25 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data
1122048140_1122048154 27 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048154 14:99038007-99038029 TGAGCCTCTCCCAGGGCCCGGGG No data
1122048140_1122048148 19 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048148 14:99037999-99038021 ACAGGCCCTGAGCCTCTCCCAGG No data
1122048140_1122048149 20 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048149 14:99038000-99038022 CAGGCCCTGAGCCTCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122048140 Original CRISPR AGCCTCAGATGGTCCCCTGT CGG (reversed) Intergenic
No off target data available for this crispr