ID: 1122048145

View in Genome Browser
Species Human (GRCh38)
Location 14:99037968-99037990
Sequence CTGCCTTCCCCAGCCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122048145_1122048149 9 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048149 14:99038000-99038022 CAGGCCCTGAGCCTCTCCCAGGG No data
1122048145_1122048148 8 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048148 14:99037999-99038021 ACAGGCCCTGAGCCTCTCCCAGG No data
1122048145_1122048153 15 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG No data
1122048145_1122048146 -10 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048145_1122048154 16 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048154 14:99038007-99038029 TGAGCCTCTCCCAGGGCCCGGGG No data
1122048145_1122048152 14 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122048145 Original CRISPR CTGCCTTCCCCAGCCTCAGA TGG (reversed) Intergenic
No off target data available for this crispr