ID: 1122048146

View in Genome Browser
Species Human (GRCh38)
Location 14:99037981-99038003
Sequence GGGAAGGCAGAGTCTCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122048145_1122048146 -10 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048135_1122048146 10 Left 1122048135 14:99037948-99037970 CCCATCTCCCCGACAGGGGACCA No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048137_1122048146 3 Left 1122048137 14:99037955-99037977 CCCCGACAGGGGACCATCTGAGG No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048134_1122048146 11 Left 1122048134 14:99037947-99037969 CCCCATCTCCCCGACAGGGGACC No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048136_1122048146 9 Left 1122048136 14:99037949-99037971 CCATCTCCCCGACAGGGGACCAT No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048139_1122048146 2 Left 1122048139 14:99037956-99037978 CCCGACAGGGGACCATCTGAGGC No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data
1122048140_1122048146 1 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048146 14:99037981-99038003 GGGAAGGCAGAGTCTCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122048146 Original CRISPR GGGAAGGCAGAGTCTCCGAC AGG Intergenic
No off target data available for this crispr