ID: 1122048152

View in Genome Browser
Species Human (GRCh38)
Location 14:99038005-99038027
Sequence CCTGAGCCTCTCCCAGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122048140_1122048152 25 Left 1122048140 14:99037957-99037979 CCGACAGGGGACCATCTGAGGCT No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data
1122048137_1122048152 27 Left 1122048137 14:99037955-99037977 CCCCGACAGGGGACCATCTGAGG No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data
1122048145_1122048152 14 Left 1122048145 14:99037968-99037990 CCATCTGAGGCTGGGGAAGGCAG No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data
1122048139_1122048152 26 Left 1122048139 14:99037956-99037978 CCCGACAGGGGACCATCTGAGGC No data
Right 1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122048152 Original CRISPR CCTGAGCCTCTCCCAGGGCC CGG Intergenic
No off target data available for this crispr