ID: 1122048803

View in Genome Browser
Species Human (GRCh38)
Location 14:99041433-99041455
Sequence CAGTCTGGCCAGAGTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122048803_1122048808 12 Left 1122048803 14:99041433-99041455 CCCTCTGCACTCTGGCCAGACTG No data
Right 1122048808 14:99041468-99041490 TGAGTGCCTCCTTATTCCTTAGG No data
1122048803_1122048809 13 Left 1122048803 14:99041433-99041455 CCCTCTGCACTCTGGCCAGACTG No data
Right 1122048809 14:99041469-99041491 GAGTGCCTCCTTATTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122048803 Original CRISPR CAGTCTGGCCAGAGTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr