ID: 1122051763

View in Genome Browser
Species Human (GRCh38)
Location 14:99065660-99065682
Sequence CTGATCTCCTGGGGGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122051763_1122051771 17 Left 1122051763 14:99065660-99065682 CCAGAGCTCCCCCAGGAGATCAG No data
Right 1122051771 14:99065700-99065722 CCCTGAAATCTCACCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122051763 Original CRISPR CTGATCTCCTGGGGGAGCTC TGG (reversed) Intergenic
No off target data available for this crispr