ID: 1122053425

View in Genome Browser
Species Human (GRCh38)
Location 14:99075613-99075635
Sequence CCTTCCCCAGGGAAGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122053417_1122053425 12 Left 1122053417 14:99075578-99075600 CCCCGTGTATCGGGAAGACGCAC No data
Right 1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG No data
1122053416_1122053425 20 Left 1122053416 14:99075570-99075592 CCAGGAGACCCCGTGTATCGGGA No data
Right 1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG No data
1122053413_1122053425 30 Left 1122053413 14:99075560-99075582 CCACAGGCTTCCAGGAGACCCCG No data
Right 1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG No data
1122053419_1122053425 10 Left 1122053419 14:99075580-99075602 CCGTGTATCGGGAAGACGCACGG No data
Right 1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG No data
1122053418_1122053425 11 Left 1122053418 14:99075579-99075601 CCCGTGTATCGGGAAGACGCACG No data
Right 1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122053425 Original CRISPR CCTTCCCCAGGGAAGGTGCC TGG Intergenic
No off target data available for this crispr