ID: 1122054270

View in Genome Browser
Species Human (GRCh38)
Location 14:99081988-99082010
Sequence GTCCCGCAGTTTTCTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122054270_1122054277 -4 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054277 14:99082007-99082029 GGACCCAGGGACAGTGCAGGGGG No data
1122054270_1122054279 -1 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054279 14:99082010-99082032 CCCAGGGACAGTGCAGGGGGTGG No data
1122054270_1122054281 0 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054281 14:99082011-99082033 CCAGGGACAGTGCAGGGGGTGGG No data
1122054270_1122054284 24 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054284 14:99082035-99082057 GTATTGTCACAGCAGACTGAAGG No data
1122054270_1122054274 -7 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054274 14:99082004-99082026 GCGGGACCCAGGGACAGTGCAGG No data
1122054270_1122054275 -6 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054275 14:99082005-99082027 CGGGACCCAGGGACAGTGCAGGG No data
1122054270_1122054282 1 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054282 14:99082012-99082034 CAGGGACAGTGCAGGGGGTGGGG No data
1122054270_1122054276 -5 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054276 14:99082006-99082028 GGGACCCAGGGACAGTGCAGGGG No data
1122054270_1122054283 2 Left 1122054270 14:99081988-99082010 CCATCCTGAGAAAACTGCGGGAC No data
Right 1122054283 14:99082013-99082035 AGGGACAGTGCAGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122054270 Original CRISPR GTCCCGCAGTTTTCTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr