ID: 1122057158

View in Genome Browser
Species Human (GRCh38)
Location 14:99108227-99108249
Sequence TCCAGGACTTTGAGAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057158_1122057162 4 Left 1122057158 14:99108227-99108249 CCTCTGCCTCTCAAAGTCCTGGA No data
Right 1122057162 14:99108254-99108276 CAGGTGTGAGCCACCGCCCCCGG 0: 143
1: 10091
2: 70134
3: 126097
4: 153625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057158 Original CRISPR TCCAGGACTTTGAGAGGCAG AGG (reversed) Intergenic
No off target data available for this crispr