ID: 1122057844

View in Genome Browser
Species Human (GRCh38)
Location 14:99117007-99117029
Sequence AATACCATCTTACGGAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057844_1122057846 -1 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057846 14:99117029-99117051 TAGACCCATTTTTACAACTGAGG No data
1122057844_1122057848 1 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057848 14:99117031-99117053 GACCCATTTTTACAACTGAGGGG No data
1122057844_1122057847 0 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057847 14:99117030-99117052 AGACCCATTTTTACAACTGAGGG No data
1122057844_1122057851 22 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057844 Original CRISPR AATACCATCTTACGGAGTTG TGG (reversed) Intergenic
No off target data available for this crispr