ID: 1122057845

View in Genome Browser
Species Human (GRCh38)
Location 14:99117015-99117037
Sequence ATGGGTCTAATACCATCTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057845_1122057851 14 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data
1122057845_1122057847 -8 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057847 14:99117030-99117052 AGACCCATTTTTACAACTGAGGG No data
1122057845_1122057848 -7 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057848 14:99117031-99117053 GACCCATTTTTACAACTGAGGGG No data
1122057845_1122057846 -9 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057846 14:99117029-99117051 TAGACCCATTTTTACAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057845 Original CRISPR ATGGGTCTAATACCATCTTA CGG (reversed) Intergenic
No off target data available for this crispr