ID: 1122057847

View in Genome Browser
Species Human (GRCh38)
Location 14:99117030-99117052
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057845_1122057847 -8 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057847 14:99117030-99117052 AGACCCATTTTTACAACTGAGGG No data
1122057844_1122057847 0 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057847 14:99117030-99117052 AGACCCATTTTTACAACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057847 Original CRISPR AGACCCATTTTTACAACTGA GGG Intergenic
No off target data available for this crispr