ID: 1122057850

View in Genome Browser
Species Human (GRCh38)
Location 14:99117034-99117056
Sequence GGGCCCCTCAGTTGTAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057850_1122057856 24 Left 1122057850 14:99117034-99117056 CCATTTTTACAACTGAGGGGCCC No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057850_1122057851 -5 Left 1122057850 14:99117034-99117056 CCATTTTTACAACTGAGGGGCCC No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057850 Original CRISPR GGGCCCCTCAGTTGTAAAAA TGG (reversed) Intergenic
No off target data available for this crispr