ID: 1122057851

View in Genome Browser
Species Human (GRCh38)
Location 14:99117052-99117074
Sequence GGCCCGTGTTTCCACCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057849_1122057851 -4 Left 1122057849 14:99117033-99117055 CCCATTTTTACAACTGAGGGGCC No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data
1122057844_1122057851 22 Left 1122057844 14:99117007-99117029 CCACAACTCCGTAAGATGGTATT No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data
1122057845_1122057851 14 Left 1122057845 14:99117015-99117037 CCGTAAGATGGTATTAGACCCAT No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data
1122057850_1122057851 -5 Left 1122057850 14:99117034-99117056 CCATTTTTACAACTGAGGGGCCC No data
Right 1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057851 Original CRISPR GGCCCGTGTTTCCACCTTAA AGG Intergenic
No off target data available for this crispr