ID: 1122057856

View in Genome Browser
Species Human (GRCh38)
Location 14:99117081-99117103
Sequence ACATTAACTAAGCAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122057852_1122057856 4 Left 1122057852 14:99117054-99117076 CCCGTGTTTCCACCTTAAAGGCA No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057849_1122057856 25 Left 1122057849 14:99117033-99117055 CCCATTTTTACAACTGAGGGGCC No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057850_1122057856 24 Left 1122057850 14:99117034-99117056 CCATTTTTACAACTGAGGGGCCC No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057854_1122057856 -5 Left 1122057854 14:99117063-99117085 CCACCTTAAAGGCAGTTCACATT No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057855_1122057856 -8 Left 1122057855 14:99117066-99117088 CCTTAAAGGCAGTTCACATTAAC No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data
1122057853_1122057856 3 Left 1122057853 14:99117055-99117077 CCGTGTTTCCACCTTAAAGGCAG No data
Right 1122057856 14:99117081-99117103 ACATTAACTAAGCAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122057856 Original CRISPR ACATTAACTAAGCAACAGCC AGG Intergenic
No off target data available for this crispr