ID: 1122060891

View in Genome Browser
Species Human (GRCh38)
Location 14:99136098-99136120
Sequence CTGGCAGCCCACTGTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122060886_1122060891 -1 Left 1122060886 14:99136076-99136098 CCTGGATGGGCCCAGGAGGTGGC No data
Right 1122060891 14:99136098-99136120 CTGGCAGCCCACTGTGGTGCAGG No data
1122060884_1122060891 0 Left 1122060884 14:99136075-99136097 CCCTGGATGGGCCCAGGAGGTGG No data
Right 1122060891 14:99136098-99136120 CTGGCAGCCCACTGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122060891 Original CRISPR CTGGCAGCCCACTGTGGTGC AGG Intergenic
No off target data available for this crispr