ID: 1122063132

View in Genome Browser
Species Human (GRCh38)
Location 14:99150350-99150372
Sequence TGGGGCTCCCTGTGACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122063132_1122063144 27 Left 1122063132 14:99150350-99150372 CCAGTGAGTCACAGGGAGCCCCA No data
Right 1122063144 14:99150400-99150422 AAAATAGACTTGCAACCCCCTGG No data
1122063132_1122063145 30 Left 1122063132 14:99150350-99150372 CCAGTGAGTCACAGGGAGCCCCA No data
Right 1122063145 14:99150403-99150425 ATAGACTTGCAACCCCCTGGAGG No data
1122063132_1122063135 -6 Left 1122063132 14:99150350-99150372 CCAGTGAGTCACAGGGAGCCCCA No data
Right 1122063135 14:99150367-99150389 GCCCCATGGCATCCAGTTGAGGG No data
1122063132_1122063134 -7 Left 1122063132 14:99150350-99150372 CCAGTGAGTCACAGGGAGCCCCA No data
Right 1122063134 14:99150366-99150388 AGCCCCATGGCATCCAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122063132 Original CRISPR TGGGGCTCCCTGTGACTCAC TGG (reversed) Intergenic
No off target data available for this crispr