ID: 1122066171

View in Genome Browser
Species Human (GRCh38)
Location 14:99175671-99175693
Sequence GCATAGGGTTGCCGCGGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122066171 Original CRISPR GCATAGGGTTGCCGCGGCCC GGG Exonic
901474228 1:9478556-9478578 GCATGGGGTTGCGGGGGTCCGGG - Intergenic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
922472052 1:225882680-225882702 GCACAGGGTGGTCGCGGCGCAGG + Intergenic
1063457644 10:6195529-6195551 GCATGGGGTCACTGCGGCCCAGG + Intronic
1064245676 10:13666036-13666058 GCGTCTGGTTGCCGGGGCCCGGG + Intronic
1075693749 10:124418768-124418790 GCGCGGGGTGGCCGCGGCCCGGG - Intronic
1077315251 11:1916805-1916827 GCATGGGGTTGCTGTGGCCGTGG - Intergenic
1077337985 11:2013933-2013955 GGATGGGGTGGCCGGGGCCCTGG + Intergenic
1202820969 11_KI270721v1_random:69115-69137 GGATGGGGTGGCCGGGGCCCTGG + Intergenic
1119261301 14:73239739-73239761 GCATTGGGTTAGAGCGGCCCGGG - Intronic
1122066171 14:99175671-99175693 GCATAGGGTTGCCGCGGCCCGGG + Exonic
1132712941 16:1277311-1277333 GCAGAGGCTTGCCGCTGCCTCGG - Intergenic
1136056236 16:27691899-27691921 GCATAGGGCTGCAGCAGCCAAGG + Intronic
1141608895 16:85170307-85170329 GCACTGGGTTCCCGAGGCCCGGG + Intergenic
1142595925 17:1030011-1030033 GCTCAGGGTGGCCCCGGCCCTGG - Intronic
1148646891 17:49224365-49224387 GCATGGGGTAGCCGCGGCGCGGG + Exonic
1154502423 18:15003456-15003478 CCATAGGCATGCTGCGGCCCTGG + Intergenic
1158282984 18:55848339-55848361 GCATTTGGGTGCCGCGGACCAGG + Intergenic
1166731966 19:45064285-45064307 GCAGAGGGGGGCCGCGGCTCAGG + Intronic
1167971997 19:53193432-53193454 GCATAGGGTGGGCGGGGCCGGGG + Intergenic
927606451 2:24491119-24491141 GCACCGGGTCGCGGCGGCCCGGG + Intergenic
938501599 2:131833628-131833650 CCATAGGCATGCTGCGGCCCTGG + Intergenic
940535437 2:154935359-154935381 GCATAGGGTTGCCAAGCACCAGG - Intergenic
1172702767 20:36863181-36863203 GCTAAGGGCCGCCGCGGCCCAGG - Exonic
1177387285 21:20425035-20425057 GCATAGAGTTGCTGCTGTCCAGG + Intergenic
1178081749 21:29073471-29073493 GCATAGGGCTGCGGCGGCCGCGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
953157460 3:40387567-40387589 GCAAAGGGATGTCGGGGCCCTGG - Intronic
954672591 3:52298807-52298829 GCATGGGGTGGCCGGAGCCCTGG - Intergenic
955971686 3:64444009-64444031 GCAGAGGGTTGACACGGCCCAGG + Intronic
965410805 3:168328253-168328275 GCATATGGTTGCAGCTGCTCTGG + Intergenic
980625573 4:135371262-135371284 GCATAGAGTTGCTGCTGTCCAGG + Intergenic
984225915 4:177034730-177034752 GCATAGAGTTCCCAGGGCCCTGG - Intergenic
991216935 5:64166091-64166113 GGCTAGGGTTGCCGCTGGCCTGG + Intronic
1004843550 6:19613927-19613949 GCATGGGGTTGCTGCTGTCCAGG - Intergenic
1013491011 6:110646423-110646445 GCATGGGGTAGCTGCGGCGCGGG - Intronic
1034514299 7:151562284-151562306 GCACAGAGCTGCCGTGGCCCAGG - Intronic
1035468292 7:159093859-159093881 GCATGGGGTGGCCGCTGTCCAGG - Intronic
1051102403 9:13535953-13535975 GCATAGGGTTGCTGAGCACCAGG - Intergenic
1056381059 9:86057677-86057699 CCATAGGCATGCTGCGGCCCTGG + Intronic
1057030686 9:91773112-91773134 GCAGAGGGCTGCAGGGGCCCTGG - Intronic
1187358558 X:18602177-18602199 GCATTGGGTTCCTGAGGCCCAGG + Intronic
1187888151 X:23908039-23908061 GCCTGGCGTTGCCGCGGCGCTGG + Exonic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic
1197911930 X:131492297-131492319 GCACAGGGGTGCCGTTGCCCCGG + Intergenic