ID: 1122073239

View in Genome Browser
Species Human (GRCh38)
Location 14:99218971-99218993
Sequence CAGGTCCAAGATGGAGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122073239 Original CRISPR CAGGTCCAAGATGGAGGGGT CGG (reversed) Intronic
900419750 1:2550788-2550810 GAAGTCCAAGATGCAGGGGCAGG - Intergenic
900425220 1:2575250-2575272 GAAGTCCAAGATGCAGGGGCAGG + Intergenic
900550287 1:3251178-3251200 CAGGTCCAAAGGGCAGGGGTGGG - Intronic
901209781 1:7518351-7518373 CAGGCCCAGGATGGAGAGGCCGG - Intronic
901329290 1:8392590-8392612 AAGCTCCTAGATGGAGGGGTGGG - Intronic
902705337 1:18200397-18200419 GAAGTCCAAGATCGAGGTGTGGG + Intronic
903065397 1:20696698-20696720 CTGGTCACAGATGGAGGGGTGGG - Intronic
903751054 1:25621050-25621072 AAGGTCCAGGAAGGAGAGGTGGG - Intronic
903816591 1:26068292-26068314 CAGCTCCTAGATGGAAGGGTCGG + Intronic
903818067 1:26079557-26079579 CAGGTTCAAGCTGTGGGGGTGGG - Intergenic
905036057 1:34918892-34918914 CGGGGCCAAGCTAGAGGGGTGGG + Intronic
905477557 1:38239560-38239582 CAGGAGCCAGATGCAGGGGTCGG - Intergenic
905762652 1:40572983-40573005 CAGGTTCCAGCTGAAGGGGTGGG - Intergenic
906375616 1:45294305-45294327 CAGGAGCAAGAAGGCGGGGTGGG - Intronic
907151233 1:52290147-52290169 AAAGTCCAAGATTGAGGGGTAGG + Intronic
908890742 1:68844678-68844700 GAGGTGCAAGATGAAAGGGTTGG + Intergenic
909621394 1:77671536-77671558 CAGGTGCTAAATGGAGGGTTTGG - Intronic
909691162 1:78409415-78409437 AAGCTCCCAGAGGGAGGGGTAGG + Intronic
909691335 1:78410441-78410463 AAGCTCCAAGTAGGAGGGGTGGG + Intronic
909773667 1:79457707-79457729 CAGGACCAAGATGGGAGGGGTGG - Intergenic
910538793 1:88331097-88331119 GAAGTCCAAGATGAAGGTGTTGG - Intergenic
910816355 1:91295352-91295374 CAAGTCCAAGATCAAGGTGTTGG + Intronic
911972440 1:104454724-104454746 GAGCTCCCAGAGGGAGGGGTGGG - Intergenic
912465659 1:109871697-109871719 CAGGACTAAGATCAAGGGGTTGG - Intergenic
913320455 1:117584902-117584924 CAGACCCAAGAAGGAGGGATGGG + Intergenic
913975206 1:143450257-143450279 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914069599 1:144275873-144275895 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914109556 1:144690481-144690503 CAGGTTCAGGATGGAGGCGGTGG - Intergenic
914215996 1:145629060-145629082 TAGTTCCAAGATGGTGGCGTAGG + Intronic
914468563 1:147951692-147951714 TAGTTCCAAGATGGTGGCGTAGG + Intronic
915567526 1:156724108-156724130 CATGTCCAAGATGGGGGCGGGGG + Intronic
915593170 1:156881963-156881985 CAGGTCCATGGAGTAGGGGTAGG - Intergenic
915839563 1:159203495-159203517 CAGGTTCAACATGAAGGGGCTGG - Intronic
915973557 1:160370671-160370693 AAGCTCCCAGAGGGAGGGGTGGG + Exonic
916240241 1:162632152-162632174 CAAGTCTTAGATGGAGGGGAAGG + Intronic
916333985 1:163649238-163649260 GAGGTCCAAGATCAAGGTGTTGG + Intergenic
916521078 1:165563885-165563907 CAGCTCCAAGGTGGTGGGATGGG - Exonic
917149628 1:171929957-171929979 GAGCTCCCAGAGGGAGGGGTGGG - Intronic
918368807 1:183838025-183838047 CTGGTCCATGGTGCAGGGGTTGG + Intronic
918413365 1:184283525-184283547 CAATTCTAAGATGGAGGGGATGG + Intergenic
918615667 1:186541167-186541189 CAGGTCCCAGGTGGAGTGCTAGG - Intergenic
918910526 1:190562811-190562833 CAGGCACAAGATGGGGGGATGGG - Intergenic
920436057 1:205947903-205947925 CAGGGCCAGGGTGGAGGGATAGG - Intergenic
920499641 1:206478039-206478061 TAGGACCAAGATGGTGGGGCAGG - Intronic
920536282 1:206738684-206738706 CAAATCCAAGTTGGAGGGGCTGG - Intergenic
920582416 1:207123956-207123978 GAAGTCCAAGATAGAGGAGTTGG + Exonic
920672464 1:208015097-208015119 TAGGTCAGAGATGGAGGGTTTGG + Intergenic
920765475 1:208828620-208828642 GAAGTCCAAGATCAAGGGGTTGG - Intergenic
921264488 1:213411029-213411051 CAGGACCAGGATGGAGAGGAAGG + Intergenic
922533933 1:226365878-226365900 CAGGCCCAGGTTGGAGGAGTGGG + Intronic
922746135 1:228045242-228045264 CAGGAGCAAGAGGGAGGGGCTGG + Intronic
922987666 1:229878584-229878606 AAGGTCAAAGATGGAGGTGCTGG - Intergenic
923770139 1:236931110-236931132 GAAGTCCAAGATGAAGGTGTTGG + Intergenic
924216186 1:241824726-241824748 CAGCTCAAAGATGGAGGGAGAGG + Intergenic
1065283813 10:24167819-24167841 GAAGTCCAAGATCAAGGGGTTGG + Intronic
1066339046 10:34511447-34511469 GAGGTCCAAGATCAAGGGGCTGG + Intronic
1067151089 10:43735496-43735518 CAGCCCCATGAAGGAGGGGTTGG + Intergenic
1068106966 10:52630701-52630723 CAAGTCCAAGATCAAGGTGTTGG + Intergenic
1068210803 10:53917907-53917929 CAGGAGCAAGAGGGAGGGGGAGG - Intronic
1070287506 10:75094620-75094642 CAGGGCCAGGCTGGTGGGGTTGG + Intronic
1071510992 10:86262492-86262514 CATGCCCAAGATGGTGTGGTGGG - Intronic
1071999907 10:91185141-91185163 GAGTTCCCAGAAGGAGGGGTGGG - Intronic
1072559145 10:96554062-96554084 CTGGTGAAAGGTGGAGGGGTTGG - Intronic
1073471593 10:103725950-103725972 CCAGTCCGACATGGAGGGGTTGG + Intronic
1073517711 10:104092311-104092333 GAAGTCCAAGATTGAGGGGCTGG - Intergenic
1073783581 10:106864995-106865017 CAGCTCCCAGAGGGAGGGGTGGG + Intronic
1074409400 10:113212337-113212359 CAAGTCCAAGATTGAGGGACTGG - Intergenic
1074754439 10:116613959-116613981 GAAGTCCAAGATGAAGGTGTAGG + Intergenic
1074801907 10:117008231-117008253 CAGGACCAAGGTGTGGGGGTTGG + Intronic
1075045937 10:119146865-119146887 CATTTCCAAGAAGGAGGGATGGG - Intronic
1075323420 10:121510683-121510705 TAGGACCAAGATGAAGGGGGAGG - Intronic
1075620288 10:123922547-123922569 CAGGTGCAAGCTGGCTGGGTTGG - Intronic
1075934034 10:126324395-126324417 CATGGCTAAGATGTAGGGGTGGG + Intronic
1076123947 10:127960112-127960134 CATGCCCAAGCTGGAGGGATTGG - Intronic
1077116897 11:889285-889307 CAGGACCAAGGTGGGTGGGTGGG - Intronic
1078065411 11:8075828-8075850 AGGGTCCAAGGTGGAGGGGCAGG + Intronic
1078257650 11:9673747-9673769 CAGCTCCAAGATAGAAAGGTTGG + Intronic
1078355169 11:10627528-10627550 GAAGTCTAAGGTGGAGGGGTGGG - Intronic
1078446511 11:11408991-11409013 CACGTCAAAGTTGGAGGAGTTGG - Intronic
1078594465 11:12674627-12674649 CCGGGCAAAGGTGGAGGGGTGGG - Exonic
1078815966 11:14822893-14822915 GAGCTCCCAGAGGGAGGGGTAGG + Intronic
1079921296 11:26437026-26437048 GAGCTCCCAGAGGGAGGGGTAGG - Intronic
1080359958 11:31501485-31501507 GAAGTCCAAGATTGAGGGGCTGG - Intronic
1080396801 11:31897744-31897766 CAGGTCCAACATGGAGCAGAGGG - Intronic
1080501500 11:32875540-32875562 GAAGTCCAAGATTGAGGGGCTGG - Intergenic
1081171072 11:39870755-39870777 GAGGTCCAAGATTAAGGGGCTGG - Intergenic
1081996355 11:47367053-47367075 CCAGTGCAAGATGGAGGGCTTGG + Intronic
1083338848 11:61945715-61945737 CAGTTCTGAGCTGGAGGGGTGGG + Intergenic
1084557345 11:69882967-69882989 CAAGTCTAAGATCGAGGGGTTGG + Intergenic
1084787527 11:71452029-71452051 CACGTCCAAGGAGGAGGGGTTGG - Intronic
1085550631 11:77367681-77367703 GAGGTCCAAGATCTAGGGCTGGG + Intronic
1086136801 11:83449871-83449893 CAACTCCAAGGTGGAGAGGTGGG - Intergenic
1087074658 11:94118186-94118208 CAAGTCAAAGATGGAAAGGTTGG - Intergenic
1087236400 11:95723710-95723732 GAAGTCCAAGATCGAGGGGCTGG + Intergenic
1087658293 11:100954042-100954064 CTGTTCCAAGATGGAGGTCTTGG - Intronic
1089462455 11:118661121-118661143 CAGGTAAGAGATTGAGGGGTGGG + Intronic
1089594235 11:119566843-119566865 AAAGTCCAAGATGAAGGGGCTGG - Intergenic
1090240745 11:125179822-125179844 CAGATCCATGATGGTGGGGGTGG + Intronic
1091531969 12:1366707-1366729 CAGGCCCAAGATAAAAGGGTGGG + Intronic
1092239717 12:6829187-6829209 CAGATCGAAGATGGAGGGACAGG + Intronic
1093387978 12:18582707-18582729 GAGCTCCCAGAGGGAGGGGTGGG + Intronic
1094131177 12:27077244-27077266 CAATTTCAAGATGGACGGGTGGG - Intergenic
1094180625 12:27589092-27589114 CAATTTCAAGATGGACGGGTGGG - Intronic
1095698283 12:45165008-45165030 GAGCTCCCAGATGGAGGGGCAGG - Intergenic
1095698366 12:45165496-45165518 CAGCTCCCAGAGGGAGGGGTGGG - Intergenic
1096044620 12:48551844-48551866 CACATCCCAGATGGAGCGGTGGG - Intergenic
1096107072 12:49002544-49002566 CAGGGCCAAGATGGAGGCAGAGG + Exonic
1096840855 12:54378707-54378729 CAGGTGCAAGCTGGTGGGGGAGG + Intronic
1096843879 12:54394934-54394956 GAGGTCCAAGGTGGAGGTGGGGG - Intergenic
1099507969 12:83501679-83501701 TAGGTCCATGACAGAGGGGTTGG + Intergenic
1099880025 12:88456564-88456586 CAGGTCCAAAATCAAGGTGTTGG + Intergenic
1099951235 12:89306733-89306755 CAGGATCAAAATGGTGGGGTAGG + Intergenic
1100269876 12:93014517-93014539 CTGGTCCAAGATGGGGGGAAAGG + Intergenic
1100411429 12:94323036-94323058 GAGCTCCCAGAGGGAGGGGTGGG - Intronic
1101463464 12:104921860-104921882 AAGGTCAAAAATGGAGGGGGTGG + Intronic
1101598937 12:106191588-106191610 CAGGTGGATGATGGAGAGGTAGG + Intergenic
1102504277 12:113373972-113373994 CATCTGCAAGATGGATGGGTGGG - Intronic
1103038747 12:117677476-117677498 GAAGTCCAAGATCGAGGTGTTGG - Intronic
1103228272 12:119306512-119306534 GAGGTCCAAGATCAAGGTGTTGG - Intergenic
1103234184 12:119358441-119358463 GAAGTCCAAGATTGAGGGGCTGG - Intronic
1103409616 12:120701497-120701519 CAGGCCCAATGTGGAAGGGTGGG - Exonic
1104396177 12:128435163-128435185 GAGGTCCAAGATGAAGGTATTGG - Intronic
1104748572 12:131224477-131224499 TGGGGCCAGGATGGAGGGGTGGG + Intergenic
1105789011 13:23779477-23779499 CAGTTCCAAGATGGACGAATAGG + Intronic
1106229199 13:27808689-27808711 GATGTCCAAGATCGAGGGGCTGG - Intergenic
1106379423 13:29222654-29222676 CCCTTCCAAGTTGGAGGGGTGGG + Intronic
1106427870 13:29650397-29650419 CAGCTACAAGATGGAAAGGTGGG - Intergenic
1110365549 13:74680980-74681002 GAGGGCAAAGATGGAGGGGTTGG - Intergenic
1110666979 13:78128293-78128315 CAGGAGCAAGAGGGAGAGGTGGG + Intergenic
1110734103 13:78914329-78914351 CAGGGACCAGATGGAGGGGATGG - Intergenic
1110867117 13:80408084-80408106 AAGGTCCCAGAGGAAGGGGTGGG - Intergenic
1113499421 13:110761410-110761432 CAGGAGCAAGATGGTGGGTTGGG - Intergenic
1113630725 13:111881875-111881897 CAAGTCCAGGATCGAGGGGTAGG - Intergenic
1116008510 14:39323451-39323473 AAGGTAAAAAATGGAGGGGTGGG - Intronic
1117435525 14:55712270-55712292 AAAGTCCAAGATCGAGGGGATGG - Intergenic
1117640832 14:57797848-57797870 CAAGTCCAAGATTAAGGGATGGG - Intronic
1119320840 14:73729464-73729486 CTGGTTCAACAAGGAGGGGTGGG - Intronic
1119611927 14:76070769-76070791 CAGGAGCAAGAGGGAGGGGTGGG - Intronic
1120878221 14:89393969-89393991 GAAGTCCAAGATGGAAGGGTTGG + Intronic
1121274751 14:92659832-92659854 AAGGTTCAAGATGAAGGTGTGGG + Intronic
1121823392 14:96990106-96990128 CAGGACCCAGATGGAAGGGTGGG - Intergenic
1122073239 14:99218971-99218993 CAGGTCCAAGATGGAGGGGTCGG - Intronic
1122397788 14:101446663-101446685 CATGAGCAAGGTGGAGGGGTAGG - Intergenic
1125523090 15:40358732-40358754 CAGGGCCTAGAAGGAGGGGCCGG - Intronic
1125610060 15:40963810-40963832 CCGATCCAAAATGGAGGGGGGGG - Intergenic
1127554438 15:60073599-60073621 GAAGTCCAAGATCAAGGGGTCGG + Intergenic
1127625503 15:60776302-60776324 CTAGTCCAAGATGAAGGGGAAGG - Intronic
1127787927 15:62372453-62372475 GAGGTCCAAGATGGATTGGTAGG - Intergenic
1128147249 15:65338587-65338609 CAGGTGCAAGAGGGAGGGTGTGG + Intronic
1129183435 15:73891501-73891523 CCCTTCCAAGTTGGAGGGGTGGG + Intergenic
1129583094 15:76832748-76832770 CAGGACCAAGAGCGAGGGGGAGG - Intronic
1130905539 15:88238156-88238178 GAAGTCCAAGATGAAGGTGTTGG - Intronic
1132189994 15:99846258-99846280 CAGGTACACAATGGAGAGGTAGG - Intergenic
1132438092 15:101828931-101828953 CAGGTCAATGAAGGAGAGGTTGG - Intergenic
1132641038 16:978714-978736 CAGGCCCCAGCTGAAGGGGTGGG + Intronic
1134819670 16:17236617-17236639 GAGGTCCAAGATCCAGGCGTTGG + Intronic
1135525553 16:23211331-23211353 AAGATCCAACATGGAGGGGTTGG + Intronic
1136381611 16:29898687-29898709 TAGATCCAAGAAGGAGGGCTGGG - Intronic
1136573884 16:31112039-31112061 CCAGGCCAGGATGGAGGGGTGGG + Intronic
1136607278 16:31344855-31344877 GAGGTTCAAGAGGGAGGGGTGGG - Intergenic
1137455529 16:48614955-48614977 AAGGTCCAAGACTAAGGGGTTGG - Intronic
1138372201 16:56536180-56536202 CAAGTCCAAGATCAAGGTGTTGG - Intergenic
1138505422 16:57476000-57476022 CAGGGCCATGCTGGTGGGGTGGG - Intronic
1138587512 16:57980188-57980210 CATGTCAAAGGAGGAGGGGTTGG + Intronic
1139840475 16:69874373-69874395 CAGTTCCAAGATGGTGGTGGTGG + Intronic
1140350605 16:74258517-74258539 CAAGTCCAAGATCAAGGTGTTGG - Intergenic
1141636348 16:85315949-85315971 CAGGACCAGGCTGGAGGGGCAGG + Intergenic
1143049304 17:4110674-4110696 AATGTCCAAGAATGAGGGGTGGG + Intronic
1143287909 17:5804958-5804980 GAAGTCCAAGATTGAGGGGCTGG + Intronic
1143583960 17:7842257-7842279 CAGGGCCCGGATGGAGGGGGCGG + Intronic
1143712288 17:8743232-8743254 AAGGACAAGGATGGAGGGGTGGG + Intronic
1143769348 17:9158146-9158168 CAGCTCCAAGAAGCAGGGGAGGG + Intronic
1143921385 17:10333320-10333342 CAGCTCCAAGGTAGAGGGCTGGG + Intronic
1144263748 17:13548216-13548238 GAGGTCCAAGATCAAGGTGTAGG + Intronic
1144641237 17:16938127-16938149 TAGGTCCAAGATCAAGGTGTCGG - Intronic
1144873781 17:18386101-18386123 TAGGTCCAAGATCAAGGTGTCGG + Intronic
1145158686 17:20559689-20559711 TAGGTCCAAGATCAAGGTGTCGG - Intergenic
1146312629 17:31780927-31780949 CAGTTCCAAGATGGATGAATAGG + Intergenic
1146664061 17:34685189-34685211 GAAGTCCAAGAAGGAGGGGGAGG - Intergenic
1147247362 17:39131233-39131255 CAGGACCAAGATCGAGGGCCAGG + Intronic
1147912059 17:43861746-43861768 CAGAACCCAGATGAAGGGGTGGG - Intronic
1148390305 17:47267412-47267434 CACGTTCAGGAGGGAGGGGTGGG + Intronic
1148529583 17:48376956-48376978 CAGGCCCAAGATGCAGAGGGAGG + Intronic
1148795876 17:50196419-50196441 CAGGGGCAAGATGGAGGCCTGGG - Intronic
1148856860 17:50583671-50583693 GAGGTGGGAGATGGAGGGGTGGG + Intronic
1149521266 17:57320011-57320033 AAGGGCCAAGTAGGAGGGGTGGG - Intronic
1150438224 17:65170522-65170544 CAGGGCTAAGGTGCAGGGGTTGG - Intronic
1150496836 17:65614293-65614315 GAGGCCCAGGACGGAGGGGTGGG - Intronic
1150592881 17:66578714-66578736 CAGGCCCAGGATGCAGAGGTGGG - Intronic
1150845207 17:68649979-68650001 GAAGTCCAAGATCAAGGGGTTGG - Intergenic
1151853475 17:76705765-76705787 GAAGTCCAAGATGGAGGTGTTGG - Intronic
1151991478 17:77577728-77577750 GATGTCCAACATCGAGGGGTTGG + Intergenic
1152122340 17:78426493-78426515 CAGGCCCATCATGGAGGGGTAGG + Exonic
1153805743 18:8706781-8706803 CAGGCCCGGGAAGGAGGGGTTGG - Intronic
1153980232 18:10302603-10302625 CAGAGCCAAGGTGGAGGGCTGGG + Intergenic
1156413950 18:36867288-36867310 CAGGAGCAAGATGGTGGGGGAGG - Intronic
1156576827 18:38326950-38326972 AAGGTCTCAGATGGAGGGGTAGG + Intergenic
1156862804 18:41857808-41857830 CACCTCCAACATGGAAGGGTAGG - Intergenic
1157298166 18:46460925-46460947 CAGGTTCATGATGGAGAGGCAGG - Exonic
1157578051 18:48757000-48757022 GAAGTCCAAGATGAAGGTGTCGG + Intronic
1157890464 18:51411168-51411190 TAGATGCAAGATGGAGGAGTGGG + Intergenic
1157907140 18:51579187-51579209 CAGGGCAAAGCTGGTGGGGTAGG + Intergenic
1158289551 18:55923830-55923852 CTGGTCCATGATCCAGGGGTTGG + Intergenic
1159040193 18:63318021-63318043 CAGGTCCGAGATGCGGGGGTTGG - Intronic
1159334233 18:67043458-67043480 CACTTCCAAGTTGGAAGGGTGGG + Intergenic
1159956587 18:74522683-74522705 GAGGTCCAAGGTGGAGGGACCGG - Exonic
1160220881 18:76976813-76976835 CAAGTCCAAGATGAAGGTGTCGG - Intergenic
1160503436 18:79413783-79413805 CAGGTCCAAGGTGGACAGGAGGG - Intronic
1161927651 19:7313068-7313090 CAGGCCCAGGATAGAGGGGAAGG - Intergenic
1162571773 19:11478538-11478560 CAGATAAAAGATGGAGGGTTAGG + Intronic
1162741396 19:12775656-12775678 CGGATCCAAGATGGCGGGGCTGG - Intronic
1163144447 19:15371196-15371218 CTGATCCAAGTTGGAGGTGTAGG - Intronic
1163329072 19:16624800-16624822 CAGGTCCAAGATGGATGCTAGGG + Intronic
1165401089 19:35600785-35600807 CAGGGGCAAGATGGAGAGGGAGG - Intergenic
1165469704 19:35996156-35996178 CAGGACCATGAGGAAGGGGTAGG + Exonic
1166090040 19:40502931-40502953 CAGGTACAAGGTGTAGGGCTTGG + Exonic
1166372690 19:42310873-42310895 TAGGTCCAAGATGGAGGGGAAGG + Intergenic
1166878723 19:45914094-45914116 CAGGTCCAAGGGGGCGGGGCTGG + Exonic
1168100242 19:54137751-54137773 CCGGTCCAAGATGGCGGCGGCGG - Intronic
1168383603 19:55944553-55944575 GAAGTCCAAGATCAAGGGGTTGG - Intergenic
1168431024 19:56280647-56280669 GAAGTCCAAGATTGAGGGGTTGG + Intronic
926249569 2:11146661-11146683 CAGATCCAAGTAGGAAGGGTTGG - Intronic
927151531 2:20199010-20199032 CAGGTGCAGGAGGGAGGGGCTGG - Intergenic
927218277 2:20682534-20682556 AAAGTCCAAGATTGAGGGGCTGG + Intergenic
930305102 2:49666876-49666898 GAGCTCCCAGAGGGAGGGGTGGG - Intergenic
930479277 2:51926446-51926468 CATGTTGAAGCTGGAGGGGTGGG - Intergenic
930586007 2:53267853-53267875 GAGCTCCCAGATGGAGGGGCAGG + Intergenic
931530601 2:63210475-63210497 AAGTTCCAAGATGGCGGGATAGG + Intronic
931694550 2:64861939-64861961 CAGGGCACAGATGGAGGGCTCGG - Intergenic
931796267 2:65712878-65712900 CAAGTCCAAGATCAAGGTGTTGG + Intergenic
932322236 2:70830823-70830845 CAGGTTAAAGTGGGAGGGGTGGG - Exonic
932992991 2:76811365-76811387 AAGGTCCAAGATGGATGAATAGG + Intronic
933648395 2:84830381-84830403 CAGATCCATGCTGGAAGGGTAGG + Intronic
934179906 2:89611230-89611252 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934290202 2:91685491-91685513 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934569590 2:95360661-95360683 GAAGTCCAAGATCGAGGGCTTGG + Intronic
934848207 2:97676937-97676959 CAGATGGAAGATGGTGGGGTGGG + Intergenic
935303519 2:101715106-101715128 GAAGTCCAAGATTGAGGTGTTGG + Intronic
935891755 2:107686769-107686791 CAGGTGCAAAATGGTGGGGAGGG - Intergenic
936973699 2:118198666-118198688 CAAGTCCAAGATGAAAGGGTTGG + Intergenic
938736549 2:134191472-134191494 CAGGTTCCAGATGGAAGGGTGGG + Intronic
940647742 2:156409143-156409165 CAGATCCAAGATCAAGGTGTTGG - Intergenic
940957056 2:159739196-159739218 CACTTCCAAGTTGGTGGGGTGGG - Intronic
941007309 2:160261327-160261349 CAAGTCCAAGATGCAGGTGCTGG + Intronic
941030013 2:160500224-160500246 CAGGTCCAAGATCAAGGTGCTGG - Intergenic
941735581 2:168971853-168971875 CAGGTCCATGATGAAGTTGTAGG + Exonic
942855660 2:180544040-180544062 GAAGTCCAAGATCTAGGGGTTGG - Intergenic
943665479 2:190604309-190604331 CAGGTCCCAGAAGTAGGTGTTGG - Intergenic
944311129 2:198235093-198235115 CAGGGACAAGAGGGAGGGGGAGG + Intronic
944618805 2:201490588-201490610 CATGTCCCAGATGGTGGGTTGGG + Intronic
944915960 2:204360437-204360459 CAGGTCCAAGATCAAGGCATTGG - Intergenic
945656592 2:212631911-212631933 CAAGTTCATGAGGGAGGGGTGGG - Intergenic
945968836 2:216216803-216216825 CACCTCCAAGGAGGAGGGGTTGG + Intergenic
946070682 2:217032097-217032119 CATGTCCAAGGAGGAGGAGTTGG - Intergenic
946271153 2:218595366-218595388 CAGATTGAAGATGGAGGGCTGGG + Exonic
946276211 2:218633764-218633786 CAGGACCAAAATGGAGGGATGGG + Intronic
947360998 2:229345335-229345357 CAGAAGCAAGATGAAGGGGTGGG - Intergenic
947864063 2:233383927-233383949 CAGGTGAATGATGGAGGGGAGGG + Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
1168881415 20:1209399-1209421 CAGATTGGAGATGGAGGGGTTGG - Intergenic
1170572045 20:17637991-17638013 CAGCTCTAAGAGGCAGGGGTGGG + Intronic
1171471858 20:25378469-25378491 AAGGTCAAGGATGAAGGGGTAGG + Intronic
1172347360 20:34213253-34213275 CAAGTCCAAGATAGAAGGGCTGG - Intronic
1174254728 20:49246135-49246157 CAGCTCCAAGAGGGAGTGTTGGG + Exonic
1174540591 20:51286210-51286232 CAGGACCAAGATGGCGAGGATGG + Intergenic
1175287743 20:57849102-57849124 GAAGTCCAAGATGGCGGTGTTGG - Intergenic
1175766112 20:61594114-61594136 CAGGGCAAAGAGGGAGGGGGAGG + Intronic
1176127433 20:63482286-63482308 CAGGACCAGCCTGGAGGGGTTGG - Intergenic
1176942393 21:14939924-14939946 CAGTTCCAAGATGGCGGAATAGG - Intergenic
1176964198 21:15193637-15193659 AAAGTCCATGATGGAGGGGTTGG + Intergenic
1176978017 21:15346243-15346265 CAGGAACAAAATGGAAGGGTGGG - Intergenic
1178142436 21:29699498-29699520 GAAGTCCAAGATGGAGGTGTCGG - Intronic
1178949530 21:36974802-36974824 GAAGTCCAAGATGAAGGTGTGGG - Intronic
1179961980 21:44772749-44772771 CAGGGCTAAGAGGAAGGGGTGGG - Intronic
1181764710 22:25083148-25083170 CAAGTCCAAGATCAAGGTGTTGG + Intronic
1182084444 22:27551637-27551659 GAAGTCCAAGATGAAGGTGTTGG - Intergenic
1182352678 22:29707628-29707650 CAAGTTCAGGATGGTGGGGTTGG + Intergenic
1183196779 22:36358919-36358941 CAGGGGCAAGATGAATGGGTGGG - Intronic
1183628555 22:39019654-39019676 CAGGTCCAACTTCGAGGGGTGGG + Exonic
1183629815 22:39026190-39026212 CAAGTCCAAGGTGGAGGGGTGGG + Intronic
1183631299 22:39034486-39034508 CAAGTCCAAGTTCGAGGGGTGGG + Intergenic
1183633257 22:39046049-39046071 CAAGTCCAAGGTGGAGGGGTGGG + Intronic
1183634819 22:39054932-39054954 CAAGTCCAAGGTGGAGGGGTCGG + Intronic
1183639011 22:39082110-39082132 CAAGTCCAAGGTGGAGGGGTGGG + Intronic
1184361443 22:44021321-44021343 CAGCTCCAAGATGGAAAGGTGGG + Intronic
1184382112 22:44151415-44151437 CAGGTCCCATCTGGAGGGGCAGG - Intronic
1184653249 22:45928822-45928844 CAGGGCCAGGATGGCCGGGTAGG - Intronic
1184722349 22:46322343-46322365 CAGCACCAAGAGGGAAGGGTGGG - Intronic
1184989953 22:48160751-48160773 GAAGTCCAAGATGGAGGTGTTGG + Intergenic
950185974 3:10945782-10945804 CAGGACTGGGATGGAGGGGTGGG - Intergenic
950315279 3:11996509-11996531 CGGGTTCATGATGGAGGGGTTGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950471178 3:13187323-13187345 CAGGGCCACAAAGGAGGGGTTGG + Intergenic
950923313 3:16716553-16716575 AAGCTCCCAGAGGGAGGGGTGGG - Intergenic
951150561 3:19284993-19285015 CAGGTCCTCGATGGTGGGGAAGG + Intronic
951469792 3:23044068-23044090 GAGTCCCAAGAGGGAGGGGTGGG + Intergenic
952866326 3:37857645-37857667 GAGCTCCAAGAGGGAGTGGTTGG - Intergenic
952989211 3:38816953-38816975 TAGGACCAAAAGGGAGGGGTAGG + Intergenic
953282358 3:41571649-41571671 CAGGTCAGAGTTGGAGGGGAGGG + Intronic
953391017 3:42533806-42533828 CAGGTCCAGGAAGGAGTGGGAGG + Intronic
953680868 3:45036959-45036981 CAGGCCCACGATGGCTGGGTGGG - Intergenic
954145792 3:48633689-48633711 CTGGTCCTAGGTGGAGGTGTAGG - Intronic
955705363 3:61722125-61722147 GAAGTCAAAGATGGAGGGGCTGG + Intronic
956060708 3:65345257-65345279 CAGGTCCAAGATCAAGGTGTTGG - Intergenic
956502385 3:69900447-69900469 CAGGGCCAAGAAGGAGGAGAAGG - Intronic
958871170 3:99560780-99560802 GAAGTCCAAGATTGAGGGGCTGG - Intergenic
960147186 3:114216001-114216023 CTGGTGCAAAGTGGAGGGGTTGG + Intergenic
960224112 3:115148691-115148713 AAGGGCCAAGATGGGAGGGTTGG + Intergenic
960561297 3:119086465-119086487 AAAGTCCAAGTTGGAGGGGGAGG + Intronic
960593904 3:119391058-119391080 CAGGACCAAGATGGCAGTGTGGG + Intronic
962357836 3:134710060-134710082 CTGGGGCCAGATGGAGGGGTGGG + Intronic
963287177 3:143444672-143444694 CAGGCCCAAGCTGATGGGGTAGG - Intronic
963899602 3:150721430-150721452 TAGGTTGAAGATGGAGGGGAGGG - Intergenic
965416169 3:168395695-168395717 CAACTACAAGATGGAGGTGTTGG + Intergenic
966780903 3:183583568-183583590 CAGGTCCAAGATGAAGACTTTGG - Intergenic
966851597 3:184168241-184168263 CAGGCCCAAGAGGGAGATGTGGG - Intronic
968513513 4:1005427-1005449 CAGGTCCAGGAGTGAGGGGAGGG - Intergenic
968940022 4:3632927-3632949 CACGTCCCAGATGGAGGTGCGGG - Intergenic
971105911 4:23524244-23524266 CTGCTCCCAGAGGGAGGGGTGGG + Intergenic
971161375 4:24137303-24137325 GAGGTCCAAGATCAAGGTGTTGG - Intergenic
971308775 4:25506264-25506286 CAGGTCCAGGATGATGGGGGCGG - Intergenic
971575619 4:28269469-28269491 GAAGTCCATGATGGAGGGGCTGG + Intergenic
974137500 4:57836806-57836828 GAAGTCCAAGATGGAGATGTCGG + Intergenic
977600416 4:98928961-98928983 CAGGTCCAACATGAAGGGGAAGG + Intronic
977816358 4:101417388-101417410 CCGTTCCAAGTTGGAGGGATGGG - Intronic
978283246 4:107042421-107042443 CAAGTCTAAGATCGAGGTGTTGG + Intronic
979728884 4:123997801-123997823 GAAGTCCAAGATCAAGGGGTCGG + Intergenic
981287389 4:143034506-143034528 CAGGAGCAAGAAGGAGGGGAGGG + Intergenic
982499137 4:156131365-156131387 GAGCTCCCAGATGGAGGGGCAGG + Intergenic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
983836985 4:172400630-172400652 CAGGTCCTAGATAGAGGAGCAGG + Intronic
983892908 4:173049311-173049333 GAAGTCCAAGATGGAGGAGCAGG + Intergenic
984869237 4:184311947-184311969 GAGGTCCCAGATGGAGGGATTGG - Intergenic
985144907 4:186886483-186886505 CAGGTTCAAGGTGCAGGAGTGGG + Intergenic
985531745 5:437662-437684 CAGGTGCCAGATTGAGTGGTGGG + Exonic
985624402 5:977530-977552 CAGGTCCAAGAGGGAAGGGCCGG - Intergenic
985675608 5:1229924-1229946 CAGGTGCAGGCTGGAGGGGAGGG + Intronic
985860749 5:2468941-2468963 CAGGTCTAGGCTGGAGGGGATGG - Intergenic
986106095 5:4661118-4661140 TAGCTTCAAGATGAAGGGGTTGG - Intergenic
986426065 5:7632991-7633013 CAGATCCAAGATCCAGGGGGAGG + Intronic
987495765 5:18642690-18642712 CACCTCCAAAATGGAGGGGAGGG - Intergenic
987952048 5:24687787-24687809 CCCTTCCAAGTTGGAGGGGTGGG - Intergenic
989437197 5:41428556-41428578 CAAGTCCAAGATCAAGGGGTTGG - Intronic
991135398 5:63176487-63176509 GAGCTCCCAGAGGGAGGGGTGGG - Intergenic
992208725 5:74456321-74456343 CAGGGCAGAGAAGGAGGGGTGGG + Intergenic
992332207 5:75728978-75729000 GAAGTCCAAGATTGAGGGGCGGG + Intergenic
993602793 5:89949412-89949434 AAAGTCCAAGATGGAGGTGTTGG - Intergenic
997399375 5:133590819-133590841 GAAGTCCAAGATTGAGGGGCTGG + Intronic
997578040 5:134997767-134997789 AAGGTCAAAGAGAGAGGGGTAGG - Intronic
997928245 5:138050535-138050557 CGAGTCCAAGATGGTGGGGCTGG - Intronic
997984725 5:138492931-138492953 CAGGAGAAAGCTGGAGGGGTAGG + Intergenic
998164509 5:139835313-139835335 CAGGTGGAAGATGGAAGGATGGG - Intronic
998384703 5:141750068-141750090 CATCTCTAAGATGGTGGGGTTGG + Intergenic
998432741 5:142080578-142080600 CAGGTCCACGACCCAGGGGTTGG - Intergenic
998638515 5:143983781-143983803 AAAGTCCAAGATCAAGGGGTTGG + Intergenic
999147245 5:149404756-149404778 CAGGTCAGAGATGGTGGGTTAGG - Intergenic
999372564 5:151064704-151064726 CAGGTCCAAGAGGGAGGCGTGGG - Intronic
1000153516 5:158527498-158527520 GAAGTCCAAGGTTGAGGGGTTGG - Intergenic
1001724848 5:173888289-173888311 CGGTTCGAAGAGGGAGGGGTGGG - Exonic
1002792885 6:448543-448565 GAAGTCCAAGATCGCGGGGTGGG - Intergenic
1002993848 6:2264382-2264404 GAGGTCCAAGATTAAGGTGTTGG - Intergenic
1003596002 6:7474706-7474728 GAAGTCCAAGATTGAGGGGCTGG + Intergenic
1003696612 6:8412191-8412213 GAAGTCCAAGATGGAGGTGCTGG - Intergenic
1003897886 6:10624697-10624719 CAGCTCTAAGATGGTGGGGCAGG - Intronic
1004350962 6:14890161-14890183 CAAGTCCAAGTTGAAGGTGTGGG + Intergenic
1004983888 6:21058773-21058795 GAGGTCCAAGATGAAGGAGCAGG - Intronic
1005776568 6:29138604-29138626 CATGTCCAAAAAGGAGAGGTTGG + Intergenic
1005810088 6:29508757-29508779 AAAGTCCAAGATCGAGGAGTCGG + Intergenic
1005818110 6:29574086-29574108 GAGGTCCAAGAAGGAGAGGTTGG - Intronic
1005819745 6:29588129-29588151 GAGGTCCAAGAAGGAGAGGTTGG - Exonic
1006829225 6:36958689-36958711 CAGGTTCATGGTTGAGGGGTAGG + Intronic
1006933334 6:37700348-37700370 AAGGTTCATGATGGCGGGGTGGG + Intergenic
1007249499 6:40486175-40486197 CAAGTCAAAGATGCAGGTGTGGG + Intronic
1007509415 6:42363853-42363875 CAAGTCCAAGATCAAGGTGTTGG - Intronic
1009413062 6:63388614-63388636 GAAGTCCAAGATGAAGGTGTTGG - Intergenic
1009423226 6:63486540-63486562 CAGGGCAAAGATGCAGAGGTAGG + Intergenic
1012237888 6:96838537-96838559 TAGGTCCAAGAAGCAAGGGTTGG - Intergenic
1012471203 6:99574466-99574488 GAAGTCCAAGATTGAGGGGCTGG + Intergenic
1013906105 6:115222087-115222109 CAGTTCCAAGATGGAAGAATAGG + Intergenic
1014463708 6:121729908-121729930 CACATCCCAGATGGAGCGGTGGG + Intergenic
1015513907 6:134066174-134066196 CTTGTCCAAGTTCGAGGGGTTGG + Intergenic
1017812879 6:157996763-157996785 CAGGACCAAGAGGGTGGGGTGGG - Intronic
1017995923 6:159531560-159531582 CAGGGCAAAGGTGCAGGGGTAGG + Intergenic
1018904728 6:168069103-168069125 CAGGTTGAAGATGTAGGGATTGG - Intronic
1019801656 7:3092286-3092308 GAGGTCCAAGATCAAGGTGTTGG - Intergenic
1020604170 7:10315191-10315213 CAAGTCCAAGATCAAGGTGTGGG + Intergenic
1021882220 7:25106080-25106102 CAGGTCCAAGATAAAGAGGGAGG + Intergenic
1022060434 7:26787687-26787709 CAGGAGCAAGAGGGAGGGGGAGG + Intronic
1022181630 7:27926105-27926127 CAGGCTCAAGATGGAGAGGAAGG + Intronic
1023042075 7:36180852-36180874 CAGGTGCATGATGAGGGGGTGGG - Intronic
1023379359 7:39591007-39591029 GAAGTCCAAGATGAAGGTGTTGG + Intronic
1023798332 7:43811935-43811957 GAGGTCCCACAAGGAGGGGTGGG + Intergenic
1024573127 7:50741775-50741797 CTGGTTCAAGATGGATGGGTTGG - Intronic
1026771906 7:73207483-73207505 CATGGCCCAGATGGAAGGGTGGG - Intergenic
1027012774 7:74760879-74760901 CATGGCCCAGATGGAAGGGTGGG - Intergenic
1027014771 7:74772808-74772830 CAGGCACTAGATGGAGGGGCTGG + Intergenic
1027073260 7:75173147-75173169 CAGGCACTAGATGGAGGGGCTGG - Intergenic
1027075266 7:75185174-75185196 CATGGCCCAGATGGAAGGGTGGG + Intergenic
1027187787 7:75982157-75982179 CAGTCCCGAGAGGGAGGGGTTGG - Intronic
1028175076 7:87646621-87646643 CAGGTCAAAGGTGGAGGTGGAGG + Intronic
1029163017 7:98566264-98566286 GAAGTCCAAGATCAAGGGGTTGG - Intergenic
1029519229 7:101049556-101049578 GAGGTCTAAGATGAAGGTGTGGG + Intronic
1032315099 7:130829981-130830003 CAGCAACAAGATGGAGGGATAGG - Intergenic
1032775582 7:135109602-135109624 GAGCTCCCAGAGGGAGGGGTGGG - Intronic
1033635106 7:143204886-143204908 CACTGCCAAGATGGAAGGGTAGG + Intergenic
1033956190 7:146851517-146851539 GAAGTCCAATATTGAGGGGTTGG + Intronic
1033985302 7:147219027-147219049 GAAGTCCAAGATGGAGAGGCTGG + Intronic
1034441977 7:151090225-151090247 CAGTTCCCAGATGGGGGGGGGGG + Intronic
1034555776 7:151849581-151849603 GAAGTCCAAGATCAAGGGGTGGG + Intronic
1034746659 7:153529299-153529321 CTGGGCCAAAATGGAGAGGTAGG + Intergenic
1036513493 8:9422074-9422096 CAGGGCCGAGGTGGAGGGCTGGG - Intergenic
1037821530 8:22137482-22137504 CAGGTCAAGGAGGGTGGGGTTGG - Intergenic
1037880145 8:22569280-22569302 CAGGCCGGAGACGGAGGGGTGGG + Intronic
1038210711 8:25516979-25517001 CAGCTGCAAGATGGAGGCGGTGG - Intergenic
1038226678 8:25664159-25664181 CAGGTCCATGGTGAAGGGCTGGG + Intergenic
1038276522 8:26126014-26126036 CAGAGCCAAGATGGTGGAGTTGG - Intergenic
1039194917 8:35020325-35020347 GAAGTCCAAGATTGAGGGGCTGG + Intergenic
1039524711 8:38203910-38203932 CAGACCCAAAATGGAGGGGGAGG - Intronic
1039545612 8:38408847-38408869 CAGGCCCAAGATGGAGGTGTCGG - Intronic
1039772575 8:40702132-40702154 GAAGTCCAAGATTGAGGGGTTGG - Intronic
1040857348 8:51961715-51961737 AAGGTCCAAGATCAAGGCGTTGG + Intergenic
1041561723 8:59226056-59226078 AAGCTCCCAGAGGGAGGGGTAGG + Intergenic
1041623743 8:60001310-60001332 GAGCTCCCAGAGGGAGGGGTAGG + Intergenic
1041684487 8:60630592-60630614 CAAGTCCAAGATCAAGGTGTTGG + Intergenic
1041860568 8:62508351-62508373 GATGTCCAAGGTGGAGGGGGAGG - Intronic
1041965571 8:63670646-63670668 CACTTCCAAGTTGGAGGGGCGGG - Intergenic
1042396227 8:68294351-68294373 AAAGTCCAAGATCGAGGTGTTGG - Intergenic
1043301858 8:78744212-78744234 GAGGTCTCAGAGGGAGGGGTGGG - Intronic
1043402276 8:79895565-79895587 GAAGTCCAAGATGAAGGTGTCGG - Intergenic
1043913205 8:85888724-85888746 AAAGTCCAAGATTGAGGGGCTGG - Intergenic
1044790690 8:95844000-95844022 GAGGTCCAAGATCAAGGTGTGGG + Intergenic
1046407399 8:113791417-113791439 CACTTCCAAGTTGGAGGGGCAGG - Intergenic
1048140616 8:131790745-131790767 GAGGTCCAAGATTAAGGAGTTGG + Intergenic
1048237025 8:132700971-132700993 GAAGTTCAAGATCGAGGGGTTGG + Intronic
1049389434 8:142360419-142360441 CGGGGCCAGGACGGAGGGGTGGG + Intronic
1049425401 8:142535822-142535844 CAGGTCCATGAGGGAGAGGATGG + Intronic
1049826963 8:144675061-144675083 CCCTTCCAAGTTGGAGGGGTGGG - Intergenic
1049835560 8:144733484-144733506 AGGGACCAAGAGGGAGGGGTTGG - Intronic
1050582452 9:7074807-7074829 CATGTCCATGCTGGATGGGTAGG - Intronic
1050966290 9:11807390-11807412 CATGTCCAAAATGAAGGTGTTGG - Intergenic
1051248147 9:15132711-15132733 CAGTGCAAAGATGGAGGAGTTGG - Intergenic
1051708073 9:19901481-19901503 GAGGTCAAAGGAGGAGGGGTTGG + Intergenic
1053035804 9:34826090-34826112 CAGTTTCCAGAAGGAGGGGTGGG - Intergenic
1054450731 9:65402351-65402373 CACGTCCCAGATGGAGGTGCGGG + Intergenic
1055016404 9:71623391-71623413 GAAGTCCAAGATGGAGGTGTTGG + Intergenic
1055158443 9:73094852-73094874 CAAGTTCAAGATTGAGGGGCTGG + Intergenic
1055158712 9:73097498-73097520 GAAGTCCAAGCTTGAGGGGTTGG + Intergenic
1055713738 9:79094269-79094291 CAGGTCCAACAAGGACAGGTAGG + Intergenic
1056791084 9:89625730-89625752 GTGGTCCAGGATGGAGGGGAGGG + Intergenic
1058437851 9:104980130-104980152 GAAGTCCAAGATTGAGGTGTGGG - Intergenic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1061348416 9:130044286-130044308 CAGGTTGAAAATGGTGGGGTGGG - Intergenic
1061419360 9:130464764-130464786 CAAGGTCAAGCTGGAGGGGTGGG - Intronic
1061486627 9:130923631-130923653 CAGATCCATGGTGGAGGGCTGGG + Intronic
1061730779 9:132612169-132612191 CATGCCCAAGGTGGAGGGATCGG + Exonic
1062329018 9:136028644-136028666 CGCTTCCAAGTTGGAGGGGTGGG + Intronic
1062535200 9:137018372-137018394 CGGGGCCAAGATGCAGGGGCGGG + Intronic
1185607811 X:1377167-1377189 CAGGTCCAAGATCAAGAGATGGG - Intronic
1185700223 X:2226036-2226058 GAAGTCCAAGATGAAGGTGTGGG - Intronic
1185876316 X:3705165-3705187 CAAGTCCAAGATGAAGGTATGGG + Intronic
1185924054 X:4127170-4127192 GAAGTCCAAGATGGAGCTGTTGG + Intergenic
1186448837 X:9655246-9655268 GAAGTCCAAGATGAAGGTGTAGG + Intronic
1188453100 X:30330122-30330144 AGAGGCCAAGATGGAGGGGTGGG + Intergenic
1190948826 X:55122293-55122315 CACTTCAAAGAAGGAGGGGTTGG + Intronic
1191123266 X:56927439-56927461 GAGCTCCCAGAGGGAGGGGTGGG - Intergenic
1192267099 X:69546557-69546579 CACTTCCAAGTTGGAGGGGTGGG + Intergenic
1192926375 X:75759025-75759047 GAGGTCCCAGAGGGAGGGGCAGG + Intergenic
1193331688 X:80241773-80241795 CACTTCAAAGAAGGAGGGGTTGG - Intergenic
1193805114 X:85985422-85985444 AAGCTCCCAGAGGGAGGGGTGGG + Intronic
1194201462 X:90957801-90957823 AAGTTCCCAGAGGGAGGGGTGGG + Intergenic
1194594048 X:95836268-95836290 AAGCTCCCAGAGGGAGGGGTGGG - Intergenic
1194743532 X:97604064-97604086 AAAGTCCAAAATTGAGGGGTTGG + Exonic
1194854763 X:98915368-98915390 GAGCTCCCAAATGGAGGGGTAGG - Intergenic
1195228800 X:102825047-102825069 GAAGTCCAAGATCGAGGGGCTGG + Intergenic
1195473641 X:105260543-105260565 GAGATCCAAGAGGGAGGGGTGGG - Intronic
1196241384 X:113346589-113346611 GAGCTCCCAGAGGGAGGGGTGGG - Intergenic
1196496462 X:116329500-116329522 CAGGCTCAAGATGGAGGGAGGGG - Intergenic
1196582134 X:117391473-117391495 GAGCTCCCAGAAGGAGGGGTGGG + Intergenic
1197122105 X:122905695-122905717 TAGGTCCCAGAGGGAGGGGCAGG + Intergenic
1198499749 X:137231781-137231803 CAAGTCCAAGATCAAGGTGTTGG - Intergenic
1199338496 X:146647635-146647657 CTGATCCAGCATGGAGGGGTTGG + Intergenic
1199394043 X:147312797-147312819 GAGCTCCCAGAGGGAGGGGTGGG + Intergenic
1199720682 X:150541049-150541071 CAGGTGCCAGATGTAGGGCTGGG - Intergenic
1199779729 X:151047167-151047189 TAGGGCCAAGTTGGAGGGGGTGG - Intergenic
1200288689 X:154850050-154850072 CAAGTCCAAGATCAAGGGGTAGG + Intronic
1200547302 Y:4533256-4533278 AAGTTCCCAGAGGGAGGGGTGGG + Intergenic
1201293669 Y:12446097-12446119 GAGGTCCAAGATCAAGGTGTGGG - Intergenic
1201958415 Y:19651047-19651069 GAGCTCCCAGAAGGAGGGGTGGG - Intergenic
1201958455 Y:19651314-19651336 GAGCTCCCAGAGGGAGGGGTAGG - Intergenic