ID: 1122076001

View in Genome Browser
Species Human (GRCh38)
Location 14:99234995-99235017
Sequence AAGTCCCTCTAGAAGAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076001 Original CRISPR AAGTCCCTCTAGAAGAGAGA CGG (reversed) Intronic
905288981 1:36908401-36908423 CAGGCTCTCTAGAAGGGAGAGGG - Intronic
905467119 1:38163515-38163537 AAGACACTCTAGAACAGAGATGG - Intergenic
905548637 1:38818646-38818668 CAGTCCCCCTAGACGAGAGGTGG + Intergenic
906288122 1:44601671-44601693 AAGGCCACCTAGCAGAGAGAGGG + Intronic
907851075 1:58255625-58255647 TAGTCCCTCTAGTAGAGATTAGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
913191634 1:116418253-116418275 AAGTCCCTTTAGAATAAGGATGG - Intergenic
915225206 1:154406386-154406408 ACTCCCCTCTAGAAAAGAGAAGG + Intronic
916546465 1:165809904-165809926 AAGTACCACTAAAAGAGAGGGGG + Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
918234205 1:182562566-182562588 AGGTCCCAGCAGAAGAGAGATGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919809962 1:201402769-201402791 CAGTCCCTCCAGCAGGGAGATGG - Intergenic
921892278 1:220365524-220365546 AAGATCCTCTACAAGTGAGAGGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1066557447 10:36630042-36630064 AAGTCAATCAAAAAGAGAGAGGG + Intergenic
1067095289 10:43295550-43295572 CAGTCCCTCAAGAGGAGAGCAGG + Intergenic
1067283036 10:44887317-44887339 ACGGCCCTCCAGAGGAGAGAAGG + Intergenic
1068360050 10:55966323-55966345 CAGTCCTTCAAGAAAAGAGAAGG + Intergenic
1068744636 10:60516397-60516419 CAGTACCCCTGGAAGAGAGAGGG + Intronic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1070167434 10:73909479-73909501 AAGTCTCTCCAGAAGACAGTGGG + Intronic
1070704075 10:78624884-78624906 GAGTCCCTCTAGCAAAGTGAGGG + Intergenic
1071048619 10:81417255-81417277 AAGCCCCTATTGAACAGAGAAGG + Intergenic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1072457057 10:95585729-95585751 AAGTCACTCTAGAGCAGGGATGG + Intergenic
1074792253 10:116902038-116902060 AAATCCCTCAAGAAGTGAAAAGG + Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1077720013 11:4618637-4618659 AAGTCCCTGGAGAAGACAGCAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078861236 11:15249174-15249196 AAGCCTCTTTAGAAGAGAGCAGG + Intergenic
1082142084 11:48620672-48620694 AAGTTCCTTTAGAAGTTAGAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083489033 11:63001191-63001213 ACGTCCCTGTAGAGGAGAGAAGG - Intronic
1085377733 11:76082055-76082077 AACTACCTCTGGAAGTGAGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086018511 11:82196748-82196770 AAGTCCCTCTGGAAGTTAAATGG + Intergenic
1086480743 11:87235253-87235275 AAGTCAGTGGAGAAGAGAGATGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092772087 12:11906019-11906041 AAGTCAATATAGTAGAGAGATGG - Intergenic
1092951050 12:13503569-13503591 CAGGGCCTCTGGAAGAGAGAAGG - Intergenic
1094438328 12:30446432-30446454 GAGTCACTGGAGAAGAGAGATGG + Intergenic
1096579313 12:52574231-52574253 AAGACCCTATAATAGAGAGATGG - Intergenic
1096749894 12:53751956-53751978 GAGACCCTGTGGAAGAGAGACGG - Intergenic
1097005217 12:55911831-55911853 AACTCCATCAAGAAAAGAGAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101669232 12:106851620-106851642 AAGTCCCTCTGAAAGATAAAAGG - Intronic
1102937308 12:116908525-116908547 AAGTTCATCAAGAAGAGAGCGGG + Intergenic
1104729959 12:131099426-131099448 AAGTCCCTGTAGTAAAGAGAAGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106899602 13:34341164-34341186 AAGTCCCCCAGGAAGATAGAAGG - Intergenic
1108069907 13:46617608-46617630 AATTCCCTCTAGCAAAGAAAAGG - Intronic
1108437261 13:50412962-50412984 ATGTGCCTCTAGAAGTGAAATGG - Intronic
1109755757 13:66757191-66757213 AAGTTGCTCTAGAAGACAGAGGG - Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110065524 13:71100912-71100934 AACTTCCTCTTTAAGAGAGATGG - Intergenic
1113332319 13:109341814-109341836 AAGTTCGTCTAGAAGGTAGAAGG - Intergenic
1114049446 14:18910820-18910842 ATGTCACTACAGAAGAGAGATGG + Intergenic
1114113117 14:19491111-19491133 ATGTCACTACAGAAGAGAGATGG - Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115587575 14:34829984-34830006 AACTCCCTCTAGAGAAGAAATGG - Intronic
1116679305 14:47945533-47945555 CCTTCACTCTAGAAGAGAGAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1118587823 14:67372331-67372353 AAGTACCTCTAGAAGAAAACAGG + Intronic
1118775929 14:68973996-68974018 AGGCCCCTCTAGCAGAGACATGG + Intronic
1120381175 14:83781713-83781735 GAGTGGCTCTAGAAGAGAGAGGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1125059099 15:35397646-35397668 AGGTACCTCTGGAAGTGAGAGGG + Intronic
1125377308 15:39043795-39043817 AGGACCCTAGAGAAGAGAGAGGG + Intergenic
1125414938 15:39442479-39442501 AATTCCATCTAGCAGAGTGAAGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126614337 15:50561482-50561504 AAGTCCCTATAGGATAGAGCTGG - Exonic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129775547 15:78234044-78234066 AAGTCCCCCTTGAGGAGACAGGG + Intronic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1135025125 16:18993801-18993823 TAGTCCCTTTGCAAGAGAGAGGG + Intronic
1135316090 16:21445551-21445573 AAGTTCTTCTAGTAGAGACAGGG + Intronic
1135369015 16:21877813-21877835 AAGTTCTTCTAGTAGAGACAGGG + Intronic
1135442801 16:22493330-22493352 AAGTTCTTCTAGTAGAGACAGGG - Intronic
1135547099 16:23373764-23373786 AAGTCCCTCCAGACGCGAGGTGG - Intronic
1136326202 16:29526038-29526060 AAGTTCTTCTAGTAGAGACAGGG + Intergenic
1136440891 16:30266022-30266044 AAGTTCTTCTAGTAGAGACAGGG + Intergenic
1136990208 16:35147333-35147355 AAGGCCCTCTCCAAGGGAGATGG - Intergenic
1137339037 16:47581299-47581321 AACTCCCTCTAGAGGATGGATGG + Intronic
1139404767 16:66709554-66709576 CAGTCTCTCTCGAAGAGACAGGG + Intergenic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1141227094 16:82128229-82128251 AAGCCCCTCTGAAAGATAGAAGG + Intergenic
1142515609 17:426419-426441 AACTCCCTATAGAACAGGGATGG - Intergenic
1145273770 17:21418211-21418233 AAGCCCGACTAGAAGAGAGCAGG - Exonic
1146061027 17:29607487-29607509 AAGTAACTCTGGAAGAGGGAGGG - Intronic
1149261058 17:54879839-54879861 CAGTCACTGTATAAGAGAGACGG + Intergenic
1149735324 17:58988445-58988467 AAGTCACTGCAGCAGAGAGAAGG + Intronic
1151310092 17:73287583-73287605 AAGCCCCTCTAGGGAAGAGAGGG - Intronic
1153943517 18:9997500-9997522 AAGACCCTCTACATGGGAGAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1161207885 19:3051318-3051340 AAGTCCCTCCAGAGTAGAAATGG + Intergenic
926323376 2:11764535-11764557 CAGGCCCTGTAGAGGAGAGATGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
927244295 2:20944343-20944365 AAGTCCACCTACAAGAGAAAAGG + Intergenic
927296263 2:21456710-21456732 AATTACCTCCAAAAGAGAGAGGG - Intergenic
929225488 2:39507838-39507860 ATCTCCCTCTGGAACAGAGAGGG + Intergenic
930897138 2:56459610-56459632 AAGTCCCATGAGAAGAGAAATGG - Intergenic
934812017 2:97287837-97287859 AATCCCCTCAAAAAGAGAGAGGG - Intergenic
934825676 2:97420090-97420112 AATCCCCTCAAAAAGAGAGAGGG + Intergenic
937198650 2:120182182-120182204 AAGTCCCCTTAGAAGGGAGATGG - Intergenic
941296748 2:163748490-163748512 AAGGACCACTAGAAGTGAGAGGG - Intergenic
945382049 2:209152071-209152093 AACACCCAGTAGAAGAGAGAAGG + Intergenic
945382223 2:209154529-209154551 AAGTCTTTCTAGATGAAAGAAGG - Intergenic
945417826 2:209597115-209597137 AATTCCCACTAGAAGAAAGGAGG - Intronic
945554984 2:211265567-211265589 TAGTCCCTTTACAAGAGTGAGGG - Intergenic
948331420 2:237169524-237169546 AAGTCTTTGAAGAAGAGAGAGGG + Intergenic
1169035544 20:2448397-2448419 AATCCCCTCCAGAAAAGAGAGGG + Intergenic
1169255188 20:4091651-4091673 AATTCCCTAGAGAAGAGAGAAGG - Intergenic
1169395353 20:5224148-5224170 AAGTCCCTTGAAAGGAGAGACGG - Intergenic
1170107550 20:12767878-12767900 CAGTCCCTCTGGCAGAGTGATGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174721031 20:52812657-52812679 AAGGCCCCCTAGAGGAGAGCTGG + Intergenic
1175244533 20:57573623-57573645 AAGTCAGTCTTAAAGAGAGAGGG + Intergenic
1176240264 20:64072648-64072670 AACTCCCACAAGAACAGAGAAGG - Intergenic
1177660437 21:24075526-24075548 AAGTCCCAATAGGAGAGCGAAGG - Intergenic
1178740699 21:35197935-35197957 AAGTTCCTTGAGAATAGAGATGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182270368 22:29149517-29149539 AAGAGCCTCTAGGAGAGAGAAGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184888126 22:47359690-47359712 AAATCCATCTAGAAGAGCAAAGG - Intergenic
949315516 3:2750559-2750581 AAGTCCCCCTTGATGAGATATGG + Intronic
949819033 3:8094998-8095020 AAGTCACTCAAGATGACAGAAGG - Intergenic
949839204 3:8301934-8301956 AAATACTTCTAAAAGAGAGAAGG + Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951203364 3:19899214-19899236 AAGGCACTGGAGAAGAGAGAGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951972570 3:28463828-28463850 AAGACCCTCTGAAAGAAAGAAGG + Intronic
952944817 3:38472277-38472299 AGGTCCCTCCATAAGAGCGAAGG - Intronic
953553025 3:43919182-43919204 AAATTGCTCTAGAAGAAAGAGGG + Intergenic
954846772 3:53566269-53566291 CAGTCACTCTTGCAGAGAGAAGG - Intronic
955117940 3:56024501-56024523 CAGTCCCTGCAGCAGAGAGAGGG + Intronic
955568264 3:60273260-60273282 AATTTCCTCTAGAAGAGAATTGG - Intronic
959933172 3:112004101-112004123 AAGTCCCCCTAGCAGGGAGCTGG + Intronic
962907379 3:139816920-139816942 AAGTCCCCAGAGAAGAGAAAAGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964479111 3:157124370-157124392 GAGTTCCTCTATAAGAAAGAGGG - Intergenic
964937719 3:162112382-162112404 AAATGTCTCTAGAAGTGAGAGGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965622798 3:170657440-170657462 AAATCCCTTTTGAACAGAGATGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
968394270 4:218960-218982 AATTCCCTCAATAAAAGAGAAGG - Intergenic
969048630 4:4356726-4356748 AAGTCAATCTAGAGGAGATAAGG + Intronic
969808725 4:9631449-9631471 AAGTCCCTTCAGAAAAGGGAGGG - Intergenic
970359726 4:15296837-15296859 AAGACCCTCAAGAAGACAGCAGG - Intergenic
970430297 4:15982890-15982912 AAGACCCTCCAGCAGACAGATGG + Intronic
972801534 4:42481126-42481148 TATTCCCTCCAGAAGAGAGTGGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
975590023 4:75990609-75990631 GGGTCCCTCCAGAGGAGAGAAGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979501669 4:121447169-121447191 AAGTCACTCCAGAAGAAAAAAGG + Intergenic
981097003 4:140792321-140792343 AAGGCCAACTAGCAGAGAGAAGG + Intergenic
982464967 4:155718816-155718838 AAGTCTGCCCAGAAGAGAGAGGG + Intronic
984252379 4:177349496-177349518 AAGTGTCTTTATAAGAGAGAGGG - Intronic
984922489 4:184778036-184778058 AAATCCCTCTAGAAAAGTGCAGG + Intronic
988374086 5:30410712-30410734 AAGTTTCTCTAAAATAGAGAAGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989822695 5:45814047-45814069 AAGTCTCTCTTTAAGAAAGATGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993276564 5:85867433-85867455 AACTCCCTCTAGCAGAGAAGTGG + Intergenic
994874810 5:105405848-105405870 AAGTTCCTGAAGAAAAGAGAAGG + Intergenic
1003627241 6:7753207-7753229 AAGTCACTTTAGAAGAGACAGGG - Intronic
1004327899 6:14693642-14693664 AAGTCCCTGGAGGGGAGAGAGGG + Intergenic
1004649594 6:17596036-17596058 AAGTCCCACTAAAAGAAACAAGG - Intergenic
1004662418 6:17722017-17722039 CAGTCCCTCTAGAGGAAACAAGG + Intergenic
1005134513 6:22552442-22552464 AAGTCCCTGTAGAATACAGTAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008423122 6:51325775-51325797 AAGTGCCATTAAAAGAGAGATGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012809777 6:103942421-103942443 CAGTGTCTTTAGAAGAGAGATGG + Intergenic
1012872937 6:104693418-104693440 CAATCCCTCGAGAAGACAGAGGG - Intergenic
1018349508 6:162942322-162942344 GAGTCCCTGAAGAAGAGAGGGGG - Intronic
1018777024 6:167027008-167027030 AAGTACATGTATAAGAGAGAAGG + Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021535295 7:21697279-21697301 AAGTCCCTCTCCAAAAGAAAGGG + Intronic
1022762541 7:33371563-33371585 AAGTCCGTGAAGAAGAGAGAGGG + Intronic
1023626488 7:42119986-42120008 AACTCCCTCTATAAGTGCGAGGG - Intronic
1025037543 7:55606543-55606565 CAGTCACTCTATAACAGAGATGG - Intergenic
1026913823 7:74107974-74107996 AAGTCCCTCTGGAGGGAAGAGGG - Intronic
1027226130 7:76244653-76244675 AAAGCCCTCTAGGAGGGAGATGG - Intronic
1027648177 7:80831238-80831260 AAGTACATCTAGAAGTGAAATGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028088412 7:86667281-86667303 AGGTCCCTAAAGCAGAGAGAAGG + Intronic
1029595284 7:101534333-101534355 AAGAACCCCTAGAAGAGAGCAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036223564 8:6940385-6940407 TGGTCACTCAAGAAGAGAGAGGG + Intergenic
1037498785 8:19465653-19465675 AAGTGCCTGAAGAAGAGAGACGG - Intronic
1037971525 8:23175082-23175104 AGGGACCACTAGAAGAGAGAGGG + Intergenic
1039782379 8:40797999-40798021 AAGACCCTGGAGAAGAGTGAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041787616 8:61652475-61652497 AATCCCCTCCAGAGGAGAGAAGG - Intronic
1042033648 8:64506190-64506212 GAGTCCCTGAAGAAGTGAGAGGG + Intergenic
1042499218 8:69490480-69490502 AAGTCACTCTATAAAACAGATGG + Intronic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1048828905 8:138457083-138457105 AAATGCCTCTAGAAAAGAGAAGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051653704 9:19356451-19356473 AAGTCCCACCCAAAGAGAGAAGG + Intronic
1052526573 9:29626810-29626832 AAGTCCCTCAAGTAAATAGATGG - Intergenic
1055129469 9:72758325-72758347 AAGTACATCAATAAGAGAGAGGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058247107 9:102640893-102640915 AACTCCCTCCTGCAGAGAGAGGG - Intergenic
1058345775 9:103959834-103959856 AAGTCCTTCCAGAAGAGACCAGG + Intergenic
1059476848 9:114554197-114554219 AACCCCCTCTAGAAGACAAATGG - Intergenic
1061748332 9:132756355-132756377 AGGTGCCTCTAGGAGAGAGTTGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188513472 X:30960993-30961015 AAATCCCTTTAAAAGACAGATGG + Intronic
1189157906 X:38778351-38778373 AACTTCCTCTAGATGAGACAGGG + Intergenic
1191867987 X:65721107-65721129 AAGTTCCTGAAGAACAGAGATGG - Intronic
1191869172 X:65731047-65731069 AAGTCCCTGTGCAGGAGAGAAGG - Intronic
1192142570 X:68658555-68658577 AAGTCCCTCGGGAGGAGAGTGGG + Intronic
1193107466 X:77693225-77693247 AGGTGCCTCTGGAAGACAGAGGG + Intronic
1195478410 X:105314871-105314893 CAGTCCCTCTGGAAAAGGGAGGG + Intronic
1196088639 X:111714347-111714369 AACTCCCTCAAGCAGAAAGAAGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1199688594 X:150288013-150288035 AAATAACTCTAAAAGAGAGAAGG + Intergenic
1200001816 X:153066008-153066030 AAGTCCCTCTGGAGGAGCGTTGG - Intergenic
1202173671 Y:22077786-22077808 TACTCACTCTAGGAGAGAGAAGG + Intronic
1202217690 Y:22508596-22508618 TACTCACTCTAGGAGAGAGAAGG - Intronic
1202325495 Y:23687463-23687485 TACTCACTCTAGGAGAGAGAAGG + Intergenic
1202545276 Y:25982591-25982613 TACTCACTCTAGGAGAGAGAAGG - Intergenic