ID: 1122076017

View in Genome Browser
Species Human (GRCh38)
Location 14:99235104-99235126
Sequence AACCCGGATGGGGCTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076017_1122076028 19 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076028 14:99235146-99235168 TCCCCACCCCTGAAGCCTCTGGG 0: 1
1: 1
2: 4
3: 37
4: 283
1122076017_1122076030 20 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076017_1122076027 18 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076027 14:99235145-99235167 TTCCCCACCCCTGAAGCCTCTGG 0: 1
1: 0
2: 6
3: 23
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076017 Original CRISPR AACCCGGATGGGGCTTTTCC AGG (reversed) Intronic
900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG + Intergenic
900653350 1:3742167-3742189 GACCCTGGTGGGGCTGTTCCAGG + Intergenic
905440604 1:37994310-37994332 AACTCATCTGGGGCTTTTCCTGG + Intergenic
915001841 1:152601073-152601095 CATCAGGATGGAGCTTTTCCTGG - Exonic
917772270 1:178292600-178292622 AAGCCAGTTGGGGCCTTTCCTGG - Intronic
917965551 1:180176309-180176331 AAGATGGATGGGGCTTCTCCAGG + Intronic
1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG + Intergenic
1070907500 10:80086289-80086311 AACCCGGAGAAGGGTTTTCCTGG - Intronic
1074337030 10:112588070-112588092 AAACCTGATGGGGCTTTTAAAGG + Intronic
1080026224 11:27617936-27617958 AACCAGGTTGGGGCATGTCCAGG + Intergenic
1083710861 11:64547464-64547486 AACCAGGAAGAGGCTTTTCCTGG - Intergenic
1089377095 11:118002148-118002170 AACCCACATGGGGTTTTTCATGG - Intergenic
1093774008 12:23051401-23051423 AACCCTGATAGTGTTTTTCCTGG + Intergenic
1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG + Intergenic
1104392778 12:128405052-128405074 AACCAGCATTGGACTTTTCCAGG + Intronic
1114039501 14:18663523-18663545 AACCCGGAGAAGGGTTTTCCTGG - Intergenic
1114119682 14:19657449-19657471 AACCCGGAGAAGGGTTTTCCTGG + Intergenic
1118442638 14:65826257-65826279 AATCTGAATGGGGCTTTTCAGGG + Intergenic
1118617171 14:67582002-67582024 AACAGGGATGGGGCTTTCTCTGG - Intronic
1119401853 14:74368104-74368126 TACTCGCATGGGGTTTTTCCAGG - Intergenic
1119425420 14:74531770-74531792 AGCCCAGATAGGGCTTTCCCTGG - Intronic
1119646979 14:76355121-76355143 TCCTCGGATGGGTCTTTTCCAGG + Intronic
1122076017 14:99235104-99235126 AACCCGGATGGGGCTTTTCCAGG - Intronic
1124661559 15:31554314-31554336 GACCTGGATGGGGCATTTCGTGG + Intronic
1124879194 15:33625896-33625918 ATACAGGATGGGGCTTTTTCTGG - Intronic
1129294394 15:74591917-74591939 AACCTGGAGGGGCCTCTTCCAGG - Intronic
1133412243 16:5578462-5578484 ACCGTGGATGGGGTTTTTCCTGG - Intergenic
1136063127 16:27740539-27740561 AACCAGGATGGGGTTTTCCCGGG - Exonic
1154276501 18:12966000-12966022 ATCCAGGTTGGGGTTTTTCCTGG - Intronic
1156924501 18:42559289-42559311 AACCCTGCTGGGGTTTGTCCAGG + Intergenic
1157902762 18:51536045-51536067 AGCCCTGATGGTGCTTTTGCAGG + Intergenic
1164422459 19:28106684-28106706 CACGTGGATGGTGCTTTTCCTGG - Intergenic
1165066019 19:33228660-33228682 AACCAGGATGGGTCTGTTTCTGG - Intergenic
926809815 2:16746226-16746248 AAGCAGGATGGGGCTTTGCCTGG - Intergenic
927659325 2:24979589-24979611 AAGTAGGATAGGGCTTTTCCTGG + Intergenic
930480438 2:51942363-51942385 AACCCTGTTGGGGCCTTTGCTGG - Intergenic
935519890 2:104091966-104091988 CCCCCAAATGGGGCTTTTCCAGG + Intergenic
937153132 2:119699638-119699660 AAGCCGGTTGGAGTTTTTCCAGG + Intergenic
939814117 2:146872751-146872773 AAGCCATATGGGGCTATTCCTGG - Intergenic
1169627104 20:7583196-7583218 AATCTGGATGAGGCTTTTCCAGG + Intergenic
1175190055 20:57205609-57205631 AACCCAGATGGTGATTTTGCTGG + Intronic
1179549565 21:42135460-42135482 AACAGGGATGGGTCTTTCCCAGG + Intronic
1180463065 22:15584634-15584656 AACCCGGAGAAGGGTTTTCCTGG - Intergenic
1182413805 22:30208284-30208306 AACCCGGATGGGGAGATTACAGG - Intergenic
1182663167 22:31939525-31939547 AACCAGGATGTGCCTTTTCTGGG + Intronic
1183277825 22:36912327-36912349 AACCCTGCAGGGGCTTCTCCAGG - Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953190171 3:40678573-40678595 AAGCAGGATGGGGCCTGTCCAGG - Intergenic
957540754 3:81566009-81566031 AACCCGAATGGGGCTGCTGCTGG - Intronic
968815404 4:2819042-2819064 TACCCGGAGGAGGCTTATCCAGG - Intronic
973611168 4:52637160-52637182 AGCCCAGAAGGGGCTTTTCGAGG - Intronic
974258302 4:59490688-59490710 AAACAGGAAGGGGCTTTTCTAGG - Intergenic
974726357 4:65803931-65803953 AACTGGGATGGGGTTTTTTCGGG + Intergenic
982421817 4:155208121-155208143 AATCCTGCTGGCGCTTTTCCGGG + Intergenic
986331239 5:6717399-6717421 AACCCAGTTGGGTCTTTGCCTGG + Intronic
996382677 5:122877979-122878001 AACCTGAATCTGGCTTTTCCTGG + Intronic
997647475 5:135490803-135490825 AAGGTGGAAGGGGCTTTTCCGGG - Intergenic
999087487 5:148905608-148905630 AAGCTGTGTGGGGCTTTTCCTGG + Intergenic
1001883917 5:175271179-175271201 AGCCCGGATGGGGTTTTCCATGG - Intergenic
1003445098 6:6176970-6176992 AAGCAGGCTGGGGCTGTTCCAGG + Intronic
1004535000 6:16491824-16491846 AAAAGGGATGGGGCTTTACCAGG + Intronic
1013298822 6:108783708-108783730 AAGCAGGATGGGGATTTTCTGGG + Intergenic
1015354270 6:132258594-132258616 TACCCTGAAGGGGATTTTCCAGG + Intergenic
1015892117 6:137979568-137979590 AACCAGGATTGGGTTTTGCCAGG - Intergenic
1017786149 6:157758699-157758721 CACCCTCATGGGGCTTATCCAGG - Intronic
1029030645 7:97463007-97463029 AACAAAGATGGGTCTTTTCCAGG + Intergenic
1034160165 7:148988037-148988059 AACAAGGATCGGGCTGTTCCTGG + Intergenic
1034472472 7:151262767-151262789 CACCCAGTTGGGGCTTTCCCTGG - Intronic
1048026510 8:130592217-130592239 AAACCTGTTGGGTCTTTTCCAGG + Intergenic
1048283600 8:133123645-133123667 GACACAGATGGGGCTCTTCCTGG - Intronic
1050740249 9:8811434-8811456 AACACTGATGGGCCTTTTCCAGG - Intronic
1052230599 9:26146178-26146200 AACCTGGTTGGAGTTTTTCCGGG + Intergenic
1052851007 9:33378398-33378420 AGCCCTGACGGGGCTCTTCCAGG + Intergenic
1062436872 9:136550301-136550323 GACCCGGCAGGGGCTTTTCTTGG + Intergenic
1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG + Intergenic
1203779484 EBV:93046-93068 AGCCCAGAGGGGGCTGTTCCTGG + Intergenic
1200372779 X:155744520-155744542 AAACGGGAAGGGACTTTTCCTGG + Intergenic