ID: 1122076017

View in Genome Browser
Species Human (GRCh38)
Location 14:99235104-99235126
Sequence AACCCGGATGGGGCTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076017_1122076030 20 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076017_1122076028 19 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076028 14:99235146-99235168 TCCCCACCCCTGAAGCCTCTGGG 0: 1
1: 1
2: 4
3: 37
4: 283
1122076017_1122076027 18 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076027 14:99235145-99235167 TTCCCCACCCCTGAAGCCTCTGG 0: 1
1: 0
2: 6
3: 23
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076017 Original CRISPR AACCCGGATGGGGCTTTTCC AGG (reversed) Intronic