ID: 1122076022

View in Genome Browser
Species Human (GRCh38)
Location 14:99235114-99235136
Sequence TTCCCCCTGAAACCCGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076022_1122076037 27 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076037 14:99235164-99235186 CTGGGGCGTCCCCTCCCAAATGG 0: 1
1: 0
2: 1
3: 8
4: 138
1122076022_1122076038 28 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076022_1122076030 10 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076022_1122076027 8 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076027 14:99235145-99235167 TTCCCCACCCCTGAAGCCTCTGG 0: 1
1: 0
2: 6
3: 23
4: 330
1122076022_1122076028 9 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076028 14:99235146-99235168 TCCCCACCCCTGAAGCCTCTGGG 0: 1
1: 1
2: 4
3: 37
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076022 Original CRISPR TTCCCCCTGAAACCCGGATG GGG (reversed) Intronic