ID: 1122076030

View in Genome Browser
Species Human (GRCh38)
Location 14:99235147-99235169
Sequence CCCCACCCCTGAAGCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 386}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076025_1122076030 4 Left 1122076025 14:99235120-99235142 CCGGGTTTCAGGGGGAATTCGAG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076023_1122076030 9 Left 1122076023 14:99235115-99235137 CCCATCCGGGTTTCAGGGGGAAT 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076017_1122076030 20 Left 1122076017 14:99235104-99235126 CCTGGAAAAGCCCCATCCGGGTT 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076024_1122076030 8 Left 1122076024 14:99235116-99235138 CCATCCGGGTTTCAGGGGGAATT 0: 1
1: 0
2: 0
3: 0
4: 79
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386
1122076022_1122076030 10 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076030 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 2
3: 42
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076030 Original CRISPR CCCCACCCCTGAAGCCTCTG GGG Intronic