ID: 1122076038

View in Genome Browser
Species Human (GRCh38)
Location 14:99235165-99235187
Sequence TGGGGCGTCCCCTCCCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 79}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076032_1122076038 -7 Left 1122076032 14:99235149-99235171 CCACCCCTGAAGCCTCTGGGGCG 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076031_1122076038 -6 Left 1122076031 14:99235148-99235170 CCCACCCCTGAAGCCTCTGGGGC 0: 1
1: 1
2: 0
3: 22
4: 301
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076026_1122076038 -1 Left 1122076026 14:99235143-99235165 CCTTCCCCACCCCTGAAGCCTCT 0: 1
1: 0
2: 10
3: 88
4: 818
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076033_1122076038 -10 Left 1122076033 14:99235152-99235174 CCCCTGAAGCCTCTGGGGCGTCC 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076029_1122076038 -5 Left 1122076029 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 1
3: 53
4: 375
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076022_1122076038 28 Left 1122076022 14:99235114-99235136 CCCCATCCGGGTTTCAGGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076023_1122076038 27 Left 1122076023 14:99235115-99235137 CCCATCCGGGTTTCAGGGGGAAT 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076025_1122076038 22 Left 1122076025 14:99235120-99235142 CCGGGTTTCAGGGGGAATTCGAG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79
1122076024_1122076038 26 Left 1122076024 14:99235116-99235138 CCATCCGGGTTTCAGGGGGAATT 0: 1
1: 0
2: 0
3: 0
4: 79
Right 1122076038 14:99235165-99235187 TGGGGCGTCCCCTCCCAAATGGG 0: 1
1: 0
2: 1
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076038 Original CRISPR TGGGGCGTCCCCTCCCAAAT GGG Intronic