ID: 1122076039

View in Genome Browser
Species Human (GRCh38)
Location 14:99235168-99235190
Sequence GGCGTCCCCTCCCAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 62}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076029_1122076039 -2 Left 1122076029 14:99235147-99235169 CCCCACCCCTGAAGCCTCTGGGG 0: 1
1: 1
2: 1
3: 53
4: 375
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076026_1122076039 2 Left 1122076026 14:99235143-99235165 CCTTCCCCACCCCTGAAGCCTCT 0: 1
1: 0
2: 10
3: 88
4: 818
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076023_1122076039 30 Left 1122076023 14:99235115-99235137 CCCATCCGGGTTTCAGGGGGAAT 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076031_1122076039 -3 Left 1122076031 14:99235148-99235170 CCCACCCCTGAAGCCTCTGGGGC 0: 1
1: 1
2: 0
3: 22
4: 301
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076025_1122076039 25 Left 1122076025 14:99235120-99235142 CCGGGTTTCAGGGGGAATTCGAG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076033_1122076039 -7 Left 1122076033 14:99235152-99235174 CCCCTGAAGCCTCTGGGGCGTCC 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076024_1122076039 29 Left 1122076024 14:99235116-99235138 CCATCCGGGTTTCAGGGGGAATT 0: 1
1: 0
2: 0
3: 0
4: 79
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076032_1122076039 -4 Left 1122076032 14:99235149-99235171 CCACCCCTGAAGCCTCTGGGGCG 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076034_1122076039 -8 Left 1122076034 14:99235153-99235175 CCCTGAAGCCTCTGGGGCGTCCC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62
1122076035_1122076039 -9 Left 1122076035 14:99235154-99235176 CCTGAAGCCTCTGGGGCGTCCCC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1122076039 14:99235168-99235190 GGCGTCCCCTCCCAAATGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076039 Original CRISPR GGCGTCCCCTCCCAAATGGG AGG Intronic