ID: 1122076712

View in Genome Browser
Species Human (GRCh38)
Location 14:99239843-99239865
Sequence TGGAATAAACAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 757}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122076709_1122076712 -4 Left 1122076709 14:99239824-99239846 CCATGTACAGACAGTGCAATGGA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 73
4: 757
1122076704_1122076712 30 Left 1122076704 14:99239790-99239812 CCCATGAACTCCAATGCTGGCTT 0: 1
1: 0
2: 1
3: 9
4: 143
Right 1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 73
4: 757
1122076705_1122076712 29 Left 1122076705 14:99239791-99239813 CCATGAACTCCAATGCTGGCTTT 0: 1
1: 0
2: 3
3: 26
4: 202
Right 1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 73
4: 757
1122076706_1122076712 20 Left 1122076706 14:99239800-99239822 CCAATGCTGGCTTTTGCTCAACG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 73
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122076712 Original CRISPR TGGAATAAACAGAAGGAGGA AGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902058916 1:13625218-13625240 TGGACTAAACAAAAGAGGGATGG - Intergenic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902586120 1:17439403-17439425 AGGAATAAAAAGAGGAAGGAAGG - Intronic
902829575 1:19002763-19002785 TGGGATAAACAGAAGGCAAATGG + Intergenic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903205152 1:21776434-21776456 AGAAATAAACAAAAGGAGAAAGG + Intronic
903606174 1:24576559-24576581 TGGAAGAGTCACAAGGAGGAAGG + Intronic
905524492 1:38625892-38625914 TGGAAAAAAGAGAAAGAGGGAGG + Intergenic
906055416 1:42912370-42912392 TGGAATAAAAAGGTAGAGGAGGG - Intergenic
906260859 1:44388662-44388684 TGGAACAAAAAGATGGAGGAAGG - Intergenic
906299417 1:44671185-44671207 TGGGAAAAAGAGAGGGAGGAGGG + Intronic
907599995 1:55759574-55759596 TGAAATGAAAAGAAGGGGGAAGG + Intergenic
907643542 1:56217219-56217241 TGGAAGAAAGAAAAGAAGGAAGG + Intergenic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
909063274 1:70903703-70903725 GGGAATAAACCAGAGGAGGAGGG + Intronic
909738850 1:79002607-79002629 TAGAATAAACTGAATTAGGAAGG + Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910168312 1:84351570-84351592 TGGATCAAGCAGAAGGAAGATGG + Intronic
910175198 1:84422589-84422611 TGTAATGAACAGAAGGAAGAAGG + Intergenic
911068491 1:93813086-93813108 TGAAATACAGAGAAGGAGAAAGG - Intronic
911105903 1:94131308-94131330 TGGAGAAAACAGAAGGAAAATGG + Intergenic
911170609 1:94767413-94767435 TGGAAAAAAAGGAGGGAGGAGGG - Intergenic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
911723646 1:101218781-101218803 TGGAAGGAAGGGAAGGAGGAAGG - Intergenic
911945747 1:104106615-104106637 TGGGAGAAAAAGAAGCAGGATGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
915047186 1:153028021-153028043 TGGAACAAACAAGACGAGGAAGG - Intergenic
915506186 1:156357785-156357807 TGGAGGAATCAGAAGGAGAAGGG + Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917577439 1:176338760-176338782 TAGAATAAACACATGGGGGATGG + Intergenic
917771883 1:178288500-178288522 TGGAATGAACACAAGCAGAAGGG - Intronic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919263260 1:195226373-195226395 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
919503742 1:198371541-198371563 TGTAATAAAAAAAAAGAGGAAGG + Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
920278607 1:204826998-204827020 GGGAAGAAAAAGAAGCAGGAAGG + Intergenic
920619387 1:207529179-207529201 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
920621169 1:207547734-207547756 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
920663661 1:207942524-207942546 TGAAAGAAAAAGAAAGAGGAAGG - Intergenic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
921487012 1:215726989-215727011 TGGAATATACAGAAACAGGATGG - Intronic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
921847632 1:219900958-219900980 TGGAATTAAAATAAGAAGGAAGG + Intronic
922133544 1:222802640-222802662 AGGAATACACAGGAAGAGGAAGG + Intergenic
922434290 1:225588178-225588200 AGGAAGAAAGAGAGGGAGGAGGG + Intronic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
922924886 1:229340601-229340623 TGCAAATAACAGAAGGTGGAGGG - Intronic
923140249 1:231155874-231155896 TGGAATAGAAAGAGGGTGGAAGG + Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063516036 10:6696445-6696467 TGGAAGAAATAGAAGAAGAAAGG + Intergenic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1065998374 10:31080968-31080990 TGGAAAAGAAAGAAGGAGGGTGG - Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066765303 10:38797241-38797263 TGGAATAGAAAGGAGGAGAAAGG - Intergenic
1066773128 10:38863154-38863176 TGGAATAAACACAAATAGAATGG + Intergenic
1066938370 10:41862997-41863019 TGGAATAAACAGCAGTGGAATGG + Intergenic
1066938752 10:41865474-41865496 TGGAATAAACAGCAGTGGAATGG + Intergenic
1066946136 10:41912408-41912430 TGGAATAAACAGCAGTGGAATGG + Intergenic
1066946604 10:41915369-41915391 TGGAATAAACAGCAGTGGAATGG + Intergenic
1066946622 10:41915469-41915491 TGGAATAAACAGCAGTGGAATGG + Intergenic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067965682 10:50910180-50910202 TGGAGTCCACAGAAAGAGGATGG + Intergenic
1068965891 10:62911806-62911828 TGCTCTAAACAGAAGGAAGAGGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070888592 10:79925750-79925772 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071296974 10:84228273-84228295 TGGGAAATACAGAAGGAGGGAGG - Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071372795 10:84969503-84969525 TGGACTAAACAGAAACAGAAAGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG + Intergenic
1072075002 10:91961819-91961841 TGGAATAATGAGAAGTGGGAAGG + Intronic
1072171288 10:92864659-92864681 TGGAATAAAAAGGTGAAGGAAGG + Intronic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1072845398 10:98824933-98824955 TGAATAAAAGAGAAGGAGGAAGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073805327 10:107091405-107091427 TCATATAAACAGGAGGAGGATGG + Intronic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074726676 10:116317447-116317469 TGGAATGAATAGAAAGTGGAAGG - Intergenic
1074915894 10:117954564-117954586 TGGAATAAAGAGAAAAAGGAAGG - Intergenic
1075667084 10:124239390-124239412 TGAAATAAACAGAGGGAGGGAGG + Intergenic
1076174418 10:128356277-128356299 TGGACTAAAGAGAAGAAGTAAGG + Intergenic
1077716539 11:4586934-4586956 TGGGATACCCACAAGGAGGAAGG - Exonic
1077717231 11:4594082-4594104 TGGGATACCCACAAGGAGGAAGG - Exonic
1077813720 11:5665015-5665037 TGAAAGGAACAGAAGGAGTATGG + Exonic
1078735220 11:14013462-14013484 GGGAATAAAAGAAAGGAGGAGGG + Intronic
1078745751 11:14112821-14112843 TGGAAGAATTAGAAGGAGCAAGG - Intronic
1078841500 11:15079786-15079808 GGGAATAAAGAGAAGAAGGGAGG + Intronic
1078892173 11:15567295-15567317 AGGAAGAAAGAAAAGGAGGAAGG - Intergenic
1078973747 11:16446989-16447011 TGGAAGAAAGGAAAGGAGGAGGG - Intronic
1080047326 11:27822437-27822459 GGGAATAAAAAGAGGAAGGAAGG - Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080122547 11:28693938-28693960 TGTAATAAAAAAAAGGAGGTCGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080855724 11:36110043-36110065 TCGAAGAAACTGAAGGAGGCTGG + Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1085059243 11:73429715-73429737 AGGAATACATGGAAGGAGGAGGG - Intronic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1086480263 11:87228250-87228272 TGGAATAAATAAATGAAGGAGGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087118518 11:94548215-94548237 TGGAATAATTAGCATGAGGAAGG + Exonic
1088164104 11:106911058-106911080 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
1088280086 11:108126721-108126743 TGCAATAAAGGGAAGGATGAAGG + Intronic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1089058360 11:115606243-115606265 TGGAATAAGTGGAAGGTGGAGGG - Intergenic
1089995581 11:122903974-122903996 TGGAAGAGTAAGAAGGAGGAAGG + Exonic
1090182735 11:124715090-124715112 AGGAATAAATTCAAGGAGGATGG + Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1092277798 12:7075351-7075373 AGGAAGGAACAGAAGGAGGGAGG - Intergenic
1093024696 12:14235132-14235154 TGGAATTGACATAAGGAGAAAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093170628 12:15856260-15856282 TGGCATACATGGAAGGAGGATGG + Intronic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1094738744 12:33264429-33264451 AGGAATAAAGAAAAGAAGGAAGG - Intergenic
1095732455 12:45521002-45521024 TGGAACAAAAAGGAAGAGGAAGG - Intergenic
1095744840 12:45646392-45646414 TGGTATAAACAATAAGAGGATGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096438544 12:51617835-51617857 TGGAATAAACAGAAATAGAATGG - Intronic
1097309978 12:58108548-58108570 TGGAGTCAAGAGAAGGAGAAAGG - Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1098773221 12:74581460-74581482 TGGAATAAACAAAATGAAAAAGG + Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099209153 12:79763441-79763463 TGGAAGAAACTGAAGAAGTAAGG - Intergenic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1099633387 12:85179095-85179117 TGGTATAAATAAAAAGAGGAAGG - Intronic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099806187 12:87522364-87522386 TGGAATAAATGCAATGAGGAAGG - Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1100343525 12:93704481-93704503 TGGAATATACAGAAGGAAAGAGG - Intronic
1100921508 12:99493568-99493590 TGGAATAAACAGTAGGATGAGGG - Intronic
1101080941 12:101183672-101183694 TGGAACAAACGCAAGGAGAAAGG + Intronic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101627480 12:106459595-106459617 TGGAATTAACAACAGGATGAAGG + Intronic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102604986 12:114061481-114061503 TGGAATTAACATAAGGAGAAAGG - Intergenic
1103063479 12:117877688-117877710 TGGATAAAACACAAGGAGGGAGG + Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104152533 12:126097268-126097290 TGGAACAAAAAGAGGGAAGAAGG + Intergenic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1105395826 13:20033439-20033461 TGTAATTTATAGAAGGAGGAAGG - Intronic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1105759400 13:23499603-23499625 TGAAAGAAACAGAAGAAGAAAGG + Intergenic
1106095848 13:26642513-26642535 TGGGAAATACAGAAGGAGAAAGG - Intronic
1106653701 13:31719535-31719557 TGGAATAAAAAGGTAGAGGAAGG - Intergenic
1106681446 13:32012537-32012559 AGGAATAAAGTGAAGGATGAGGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107170215 13:37332398-37332420 TGGACCAAACAGCAGGACGAGGG + Intergenic
1107739260 13:43432007-43432029 TGGAATAAACAGGCGTAGGATGG - Intronic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1108327416 13:49347856-49347878 AGGAAGGAAAAGAAGGAGGAAGG - Intronic
1108555416 13:51586362-51586384 TGGAATCAAGAAAAGGAGAAGGG + Intronic
1108903644 13:55444178-55444200 AGGAACAAACAGAGGAAGGAGGG - Intergenic
1109051304 13:57485317-57485339 TGGAATAAACTTAAGTAAGAAGG + Intergenic
1109207015 13:59493691-59493713 TTGAATAACCACAAGGATGAAGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109532386 13:63666729-63666751 TGGCATAAACACAAGAATGAAGG + Intergenic
1110398877 13:75066285-75066307 AGGCATAAAGAGATGGAGGATGG + Intergenic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1110485010 13:76029050-76029072 TGGATTAACTAGAAGGAAGATGG + Intergenic
1110541764 13:76713913-76713935 TGGAACAAAAAAATGGAGGAGGG + Intergenic
1110907427 13:80909854-80909876 TGAAATAAAGAGAAGGATTAAGG - Intergenic
1111051661 13:82890171-82890193 AGGAATACACAGACGGAGGTAGG - Intergenic
1111537420 13:89621211-89621233 GGGAATAAAAGGAGGGAGGAAGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1112154683 13:96804338-96804360 TGGTATAAAGAGGAGGAGGGAGG + Intronic
1112736438 13:102425523-102425545 TGGAATTAACTGAAGAAAGAAGG + Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1114299568 14:21362620-21362642 TGAAAAAAACTGAAAGAGGAAGG + Intronic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115569458 14:34653098-34653120 TGGAATTGACATAAGGAGAAAGG - Intergenic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1115939231 14:38589976-38589998 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939238 14:38590001-38590023 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939245 14:38590026-38590048 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939252 14:38590051-38590073 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939259 14:38590076-38590098 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939266 14:38590101-38590123 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116376797 14:44212528-44212550 AGGACTAAACAGTAGAAGGATGG + Intergenic
1116788950 14:49318937-49318959 TGGAAAGGAGAGAAGGAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1117141238 14:52792299-52792321 TGGAATCTACAGATGGTGGAGGG + Intergenic
1118263790 14:64273823-64273845 TGAAAAATAGAGAAGGAGGAGGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119818923 14:77596824-77596846 TGGTATGAACAGAAAGAGCAAGG + Intronic
1120125055 14:80732010-80732032 TGGAAAAAAAAGAGGTAGGAGGG + Intronic
1121028622 14:90637548-90637570 TGGCAAGAACAGAAGGAGAAAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121882181 14:97510673-97510695 TGAAATAAACAAAAGCATGAAGG - Intergenic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1121933563 14:97995771-97995793 TGGAGTAGAGAGAGGGAGGATGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1124389032 15:29236870-29236892 TGAAATAAAAAAAAGAAGGAAGG + Intronic
1124896128 15:33779081-33779103 TGAACTAGAGAGAAGGAGGAGGG - Intronic
1125452828 15:39826750-39826772 TGGAGTAAACAGAAGCCAGAGGG + Intronic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125832158 15:42724618-42724640 TGGAATACATAGAAAGATGAGGG + Intronic
1125860587 15:42995814-42995836 TGTTATAAAATGAAGGAGGAGGG + Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127289868 15:57560583-57560605 TGGAAAAAACAGAGGGAACACGG + Intergenic
1127364171 15:58271900-58271922 TGGAAAGACCAGCAGGAGGAAGG + Intronic
1127715940 15:61649577-61649599 TGGAAAACACAGAAGAACGAAGG - Intergenic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1128662291 15:69510912-69510934 TGGAACAAAAAGATGGGGGAAGG + Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129076387 15:72999992-73000014 GGGAATAAAATGAAGGAGAAAGG - Intergenic
1129378688 15:75152052-75152074 TGAAATGAACAGAAATAGGAAGG + Intergenic
1129969404 15:79764201-79764223 GGGAAGGACCAGAAGGAGGAAGG + Intergenic
1130001659 15:80053114-80053136 TGTAATGAATAGAAGGAGGTGGG + Intergenic
1130635444 15:85615004-85615026 TGAAATAAAAGGAGGGAGGAAGG - Intronic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1131805292 15:96115640-96115662 TGGAAAGAACAGAAGAAGGAAGG + Intergenic
1131826930 15:96329935-96329957 AGGAATAAACAGAAACAGAACGG + Intronic
1131929863 15:97429740-97429762 TGGAAAAAACAGGAGCAAGAAGG - Intergenic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1132005328 15:98221390-98221412 TGAATTAAAGAGAAGAAGGAAGG + Intergenic
1132072571 15:98791878-98791900 GGGAAGAAATAGAAGAAGGAAGG + Intronic
1133450833 16:5902764-5902786 TGGAATCAAAAAAAGGAGGGTGG - Intergenic
1134852268 16:17489613-17489635 TGGATTAAACGAATGGAGGAAGG + Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1136083686 16:27869231-27869253 TGGAGAGAACAGAAGAAGGAGGG + Intronic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1137645513 16:50069932-50069954 TGTAATAAACAGAAGGTGCTAGG + Intronic
1138529568 16:57627837-57627859 AGGAATGACCAGAAGGGGGATGG + Intronic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1138894810 16:61190751-61190773 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1138894817 16:61190781-61190803 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1139028720 16:62852743-62852765 TGAACTAAAGAGCAGGAGGATGG + Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1140024567 16:71273790-71273812 TGGAATTAACAGATTGAAGATGG + Intergenic
1140105678 16:71957753-71957775 TGGACTAAAAAGATGGAAGAAGG + Intronic
1140232568 16:73129911-73129933 TGCCTTAAACACAAGGAGGATGG - Intronic
1140620337 16:76722525-76722547 TGTATTAAACACAAGGAGTAAGG + Intergenic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1141696961 16:85624727-85624749 TGGAATAAACAGGTGGAGAGAGG + Intronic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142728126 17:1831156-1831178 TGGAATAAGCAGACAGATGACGG - Intronic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143384837 17:6522891-6522913 GGGAATAAAGACAAGCAGGATGG - Intronic
1143536482 17:7543375-7543397 TGGAAGGAACAGAGGGAGGCAGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1145106735 17:20124089-20124111 TGGATGCCACAGAAGGAGGAGGG + Intronic
1145970891 17:28955853-28955875 TGGTATATACAGGAGGTGGAGGG + Exonic
1147111853 17:38268536-38268558 TGGAAAAAATAAAAGGAGGTAGG - Intergenic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1148148140 17:45378966-45378988 TGGAGTAGACAGTCGGAGGATGG - Intergenic
1148417720 17:47520265-47520287 TGGAAAAAATAAAAGGAGGCAGG + Intergenic
1148641988 17:49194473-49194495 AGAAAAAAAGAGAAGGAGGAGGG - Intergenic
1148828384 17:50411977-50411999 TGGAATGAACAGAGGGGAGAAGG - Intergenic
1149014107 17:51888218-51888240 AGGAAGTAACAAAAGGAGGAAGG + Intronic
1149034298 17:52116562-52116584 GGGAATAAAAAGATGGAAGAAGG + Intronic
1149522037 17:57324720-57324742 TGGAAGAAAGTGAAGGAGGAGGG - Intronic
1149647876 17:58253550-58253572 TGGAATGAACAGAATTAGCAGGG - Intronic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1151345819 17:73500594-73500616 TGGAGGAGATAGAAGGAGGATGG - Intronic
1151345842 17:73500695-73500717 TGGAGGAGACGGAAGGAGGATGG - Intronic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152775825 17:82201414-82201436 TGGAATCAGCAGCGGGAGGAGGG + Intronic
1153090369 18:1335717-1335739 TGGAATCTACAGAAGCAGGCAGG - Intergenic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1155409916 18:25532593-25532615 GGTAATAAACAGAAGGAAGGAGG + Intergenic
1155437273 18:25826442-25826464 TGGAAGAAACCCACGGAGGAAGG - Intergenic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1155914409 18:31541924-31541946 TGGAAGAAAAACAAGGAAGAGGG - Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156598075 18:38570835-38570857 TGGAAAGAACAGAAGAAGGAGGG + Intergenic
1156665916 18:39406778-39406800 TGGAATAAACAGGTCAAGGAAGG - Intergenic
1157310884 18:46552447-46552469 TGGTGGAAACACAAGGAGGAGGG - Intronic
1157722616 18:49937043-49937065 AGGAACTAACAGAGGGAGGAGGG - Intronic
1158508299 18:58066789-58066811 TGGAAGAATCAGGAGGAAGAGGG + Intronic
1158736036 18:60080964-60080986 TGCAATAAACACAGGGAGGCAGG - Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159259514 18:65994153-65994175 TGGTATAACCAGAAGCAGGGAGG - Intergenic
1159448958 18:68575821-68575843 AGGAAAAAAGAAAAGGAGGAAGG - Intergenic
1159844013 18:73437119-73437141 TGGAAAGAAGATAAGGAGGAAGG + Intergenic
1159857704 18:73608651-73608673 TGGAAAAAATAAAAGGAGAAGGG - Intergenic
1160000032 18:75009066-75009088 TGGAATAAACAGAAGAGAAAGGG - Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1161329094 19:3677972-3677994 AGGAATAGAGGGAAGGAGGATGG + Intronic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162776667 19:12983886-12983908 TGAAAGAGACAGAAGGAGGAAGG + Intergenic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1164875674 19:31685093-31685115 TGGAATAAACAGAACAAATATGG - Intergenic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
1165733911 19:38163905-38163927 GGGAATAAACAGGGGGATGAGGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1167322348 19:48805011-48805033 AGGAAAAAACAGAGGGAGGGAGG + Intronic
925202877 2:1983170-1983192 TGGAAGGAACCGACGGAGGAGGG - Intronic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
925803405 2:7625045-7625067 TGGAATGAACAATAGCAGGATGG + Intergenic
925878649 2:8332660-8332682 TGAAATAAACAAAAGGAGTGGGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926962850 2:18377899-18377921 TGGACTGAATGGAAGGAGGATGG + Intergenic
927502193 2:23590351-23590373 TGGAACAAACAGCAGGGAGAAGG - Intronic
928405792 2:31013710-31013732 TGGCATTAACAGAAAGAGCATGG - Intronic
928406230 2:31017100-31017122 TGGCATTAACAGAAAGAGCATGG - Intronic
930098408 2:47584663-47584685 TGGAATTGACATAAGGAGAAAGG + Intergenic
930285730 2:49425062-49425084 TGGAAAACAGAGAAGCAGGAAGG + Intergenic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
930482678 2:51968804-51968826 TTTATTAAACACAAGGAGGAGGG + Intergenic
931121617 2:59226367-59226389 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
931159479 2:59673159-59673181 TGCACTAAACTGCAGGAGGAAGG + Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
932193271 2:69759341-69759363 TGGAATAAACAGAAAGTAGATGG + Intronic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933053978 2:77638294-77638316 AGGAAGAAAGAGAGGGAGGAGGG - Intergenic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
934123039 2:88858210-88858232 TGGAACAGTCAGAAGGTGGAGGG - Intergenic
934720925 2:96576110-96576132 TGGAACCAACAGAAAGTGGATGG + Intergenic
935450265 2:103201079-103201101 TGGAATCTACAGAAGCAGGCAGG - Intergenic
935484742 2:103639740-103639762 TGGAAAGAAGAGAGGGAGGAGGG + Intergenic
935542132 2:104361118-104361140 TGGAATGAACAGGAGGATGAAGG + Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
935954420 2:108361641-108361663 AGGAATAGACTGAAGGAGTAGGG - Intergenic
936284044 2:111167384-111167406 TGGAACAAACAGAAGGTTGCTGG - Exonic
936527984 2:113255111-113255133 AGGAATAGAGGGAAGGAGGAAGG + Intronic
936599371 2:113880869-113880891 TGGAATAAAAGGGAGAAGGATGG - Intergenic
936758159 2:115739449-115739471 TGGAGTAATCAGAATGAGAACGG - Intronic
937419258 2:121740847-121740869 AGGAAGAAAGGGAAGGAGGAAGG - Intronic
938385828 2:130866383-130866405 TGGAAAAAAAAGAAGAAGGTGGG + Intronic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
938622061 2:133066527-133066549 AGGAAAAAATAGAAGAAGGAAGG - Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
938926941 2:136052101-136052123 TGGAATACACAGAGGGAGCTGGG + Intergenic
938945522 2:136208650-136208672 TGGAATAGACAGAGGGAACAGGG + Intergenic
940110594 2:150148298-150148320 TGAAGGAAAAAGAAGGAGGAAGG + Intergenic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
941646999 2:168051259-168051281 TGGAATATAAAAAAGGATGAGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942069318 2:172301183-172301205 TGGAAGAAAAAGAAAGAGAAGGG - Intergenic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942535022 2:176954298-176954320 AGAAATGAAGAGAAGGAGGAAGG + Intergenic
943126494 2:183799412-183799434 AGGAATAAACTTAATGAGGAAGG - Intergenic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944130504 2:196342490-196342512 TGGAATATATAGAAGAAGGAAGG - Intronic
944403902 2:199360709-199360731 TGTAATTATCAGAAAGAGGATGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945689603 2:213016955-213016977 TGTTATCAAGAGAAGGAGGAAGG + Intronic
945734778 2:213585926-213585948 GGAAAAAAAAAGAAGGAGGAGGG - Intronic
946107413 2:217383737-217383759 TGGAATAACCAGCAGGATGACGG + Intronic
946295820 2:218782623-218782645 TGAGATAAACAGGACGAGGAAGG + Intronic
947029911 2:225782502-225782524 GGGAAAAAAAGGAAGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947189461 2:227487119-227487141 AGAAATTAACAGAAGGAGGGCGG - Intronic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169531922 20:6494573-6494595 TGGGAAATACAGAAGGAGTAAGG + Intergenic
1169748959 20:8972322-8972344 TGGCATGAAAAAAAGGAGGAGGG - Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1170305748 20:14935946-14935968 TGGAAAAAAGAAAAGAAGGAAGG - Intronic
1171916971 20:31068808-31068830 TGGAATAAACTGAAGTGGAATGG + Intergenic
1171916997 20:31068968-31068990 TGGAATAAACAAAAGTGGTATGG + Intergenic
1172014870 20:31867341-31867363 TGGAAAGAACAGAATGAGCAAGG - Intronic
1172058049 20:32167865-32167887 TTGAATAAACTGAAGTGGGAAGG - Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1173134999 20:40431779-40431801 TGGAATCCAGAGAAGGATGAAGG - Intergenic
1173240992 20:41297142-41297164 TTGAATCAACACAAGGAGAATGG + Intronic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173430998 20:42987119-42987141 TGGAAACAACAGAGGGAGGCAGG - Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174925792 20:54758218-54758240 TCAAATAAACAAAAGGATGAAGG - Intergenic
1175081856 20:56427297-56427319 GGGAAGACAGAGAAGGAGGAAGG - Intronic
1175344133 20:58259356-58259378 AGGAAAAAACAAAAGAAGGAAGG + Intergenic
1175535764 20:59710271-59710293 TGGGATAAAAAGCAGGAGAATGG - Intronic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178243353 21:30927765-30927787 TGCAAGAGACAGAAGGAGAAAGG + Intergenic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1181091038 22:20472815-20472837 TGGAATGATGAGAAGGAGCAGGG + Intronic
1181882877 22:25995253-25995275 GGGAATAGACAGTAGGAGGTGGG + Intronic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1182266505 22:29120015-29120037 TGAAGGAAACAGAGGGAGGAAGG + Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182933802 22:34200903-34200925 TGTAATAAAGAGAAGGGGAATGG - Intergenic
1183104700 22:35607516-35607538 TGGAATAAAGAGAAGGTAGGAGG - Intronic
1183169540 22:36176475-36176497 TGGTATAAAAAGAAGGATAAGGG - Intergenic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
950645586 3:14374696-14374718 TGGCAGAGACAGCAGGAGGAGGG + Intergenic
950668393 3:14511017-14511039 TGGAATGAACAAATGAAGGAGGG - Intronic
950770280 3:15305712-15305734 TGCAAGAAACTGAAGGAGGCCGG + Intronic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
951169824 3:19528072-19528094 TGGAAGAATAAGAAGGAGAAGGG + Intronic
951296490 3:20942440-20942462 TGGAATATAGAAAAGGGGGAGGG + Intergenic
952297513 3:32074274-32074296 TGGAATTGACATAAGGAGAAAGG - Intronic
952469463 3:33630909-33630931 TGTAAAACACAAAAGGAGGAAGG + Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953095600 3:39771912-39771934 AGGAATACACAGAAGGAGTGTGG + Intergenic
953903732 3:46857834-46857856 AGGAAAAAAGAGAGGGAGGAAGG + Intergenic
953916381 3:46923444-46923466 TGGGAGAAAGAGGAGGAGGAAGG + Intronic
955889171 3:63632129-63632151 TGGAAGAAAGGGAAGAAGGAAGG + Intergenic
955889200 3:63632230-63632252 TGGAAGAAAGGGAAGAAGGAAGG + Intergenic
956521966 3:70114598-70114620 TGGACTAAACAGAGGCACGAAGG - Intergenic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
956827181 3:73008282-73008304 TGGAATATACAGAAGCAAAAGGG - Intronic
957533851 3:81475620-81475642 TGGAAATAAAAGAAGGAGGTTGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958588812 3:96126408-96126430 TGCAATAAACATAAGAAGGCAGG - Intergenic
959405652 3:105959229-105959251 AGGAACAAACAGAAGAAAGAAGG - Intergenic
959587426 3:108037987-108038009 TGGAATGCAAAGAAGGTGGAAGG - Intergenic
959683436 3:109121714-109121736 TGGAACAAAAAGATAGAGGAAGG + Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962714826 3:138116812-138116834 TGGAAAAAAGAGAAAGAGGGAGG - Intergenic
963569402 3:146973302-146973324 TGGATTAAAGAGTAGGATGAAGG + Intergenic
964023248 3:152040776-152040798 TGGCAAAAACGGAAGGAGGTAGG + Intergenic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
965490246 3:169326072-169326094 TGGAACACAGAGAAAGAGGAGGG + Intronic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
965774363 3:172213049-172213071 TGGAAGAAAAAGAAAAAGGAAGG - Intronic
967512959 3:190334389-190334411 TGGAATAAAGAGACTGAGAAGGG + Intronic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968020417 3:195382469-195382491 GGGAATGAAAAGAAGAAGGACGG - Intronic
968412405 4:401478-401500 TGGAATTGACATAAGGAGAAAGG + Intergenic
968463769 4:739486-739508 TGGAATAAACAAAAACAGGCTGG - Intronic
968793675 4:2687701-2687723 TGGATGAACCAGAAGGCGGAAGG - Intronic
969334997 4:6502549-6502571 TGGAATAAAAGGAAGGAAAAAGG - Intronic
969346507 4:6573858-6573880 TGGACAGGACAGAAGGAGGAGGG + Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970894206 4:21083627-21083649 TGGAATTACCAGAAGCTGGAAGG + Intronic
970947702 4:21714530-21714552 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
972089385 4:35260952-35260974 TGAATTAATCAAAAGGAGGATGG - Intergenic
972352001 4:38244565-38244587 TGGAAGCAAGGGAAGGAGGAGGG - Intergenic
973952942 4:56036033-56036055 TGGAGTAAACAGAAGACTGATGG - Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974277348 4:59740253-59740275 AGGAAGGAAAAGAAGGAGGAAGG - Intergenic
974316931 4:60294656-60294678 TGAAAGAGAAAGAAGGAGGAAGG + Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974831474 4:67194718-67194740 AGGAAGGAAGAGAAGGAGGAAGG + Intergenic
975481386 4:74884426-74884448 TGGAAGAGAGAGAAGGGGGAGGG - Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975759426 4:77604340-77604362 TGCGATAGACAGAAGGAGGAAGG - Intronic
976188403 4:82466046-82466068 AGAAATAAATAGAAAGAGGATGG - Intergenic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976335823 4:83884984-83885006 TGCAATAATCAAAAGGAGGGTGG - Intergenic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976843192 4:89456053-89456075 TGGAATAAATACAAGGAACAAGG - Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
978157570 4:105507406-105507428 TGAAAAAACCAGAAGGAAGATGG + Intergenic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978690978 4:111509128-111509150 TGGAATAAAAATCAAGAGGAAGG + Intergenic
978995845 4:115151354-115151376 AGGAAGAAACACAAGGAAGAAGG - Intergenic
979318510 4:119296661-119296683 TGGAATAAAAAGGCAGAGGAAGG - Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
980223574 4:129951137-129951159 AGGAAAAGACAGAAGGAGGGAGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
980939484 4:139260208-139260230 TCTAAAAAACAGAAGAAGGAAGG + Intergenic
980990895 4:139737447-139737469 TGGAATAAAAAGAAATGGGAAGG + Intronic
981389676 4:144173828-144173850 TGGAATAAACAGAAGAGTGCAGG - Intergenic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984612354 4:181855949-181855971 AGGAAGGAACAAAAGGAGGAAGG + Intergenic
984699904 4:182812427-182812449 TGGAAGATTCAGAAGAAGGAAGG - Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984886997 4:184457966-184457988 TGGAACAAACAGATGAAGGAGGG - Intronic
985341572 4:188960273-188960295 TGGAATAAAAAAAAGGAAGGAGG - Intergenic
985974391 5:3404547-3404569 TGCAATGAACAGAATGAGGAAGG - Intergenic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986645178 5:9910299-9910321 TGTGATAAACAGAAGTAGGAAGG + Intergenic
986768533 5:10950127-10950149 TGGAATGGACAGAGGAAGGAGGG + Intergenic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987144739 5:14981236-14981258 TAAAATGAACAGAAGTAGGAAGG - Intergenic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
987734399 5:21821256-21821278 TGCAATAAACAAAAAAAGGAAGG - Intronic
988166636 5:27598783-27598805 TGGTACAAATAGAAGGAGAAAGG - Intergenic
988874728 5:35431363-35431385 TGCAATAACAAGAAGTAGGAGGG + Intergenic
990181417 5:53164696-53164718 TGGTAAAAACAGAAGGACAAAGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
991975154 5:72177921-72177943 AGGAAAAAAGAGAGGGAGGAAGG - Intronic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992603549 5:78431479-78431501 TGGAATAAACAGAAAATAGATGG - Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
993502204 5:88676688-88676710 TTAAATAAACAGAAGCAGGGAGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
994695103 5:103064089-103064111 TGGAAATGACAGAATGAGGAAGG - Intergenic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995688664 5:114799242-114799264 AGGAATAGAGGGAAGGAGGAGGG + Intergenic
995689629 5:114809951-114809973 TGGAATAAACAATATGAGCAAGG + Intergenic
996111534 5:119571622-119571644 AGGATTAAACAGAAGGTGAAGGG - Intronic
996678186 5:126201015-126201037 TGGAATGAATAGAAGGGGAAAGG - Intergenic
996971356 5:129372202-129372224 TGGAATAAAGAGAAGGGAAATGG + Intergenic
997143911 5:131411774-131411796 TGAAATAATCAGAGGGAGAATGG - Intergenic
997157950 5:131578550-131578572 TGGAATTGACATAAGGAGAAAGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998345011 5:141454694-141454716 TGGAATAAGCAGGTGGAGCATGG - Intronic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999047500 5:148485004-148485026 AGGAAGAAAGGGAAGGAGGAAGG + Intronic
999405436 5:151302922-151302944 TGGAAGAAAGAAAGGGAGGAAGG + Intronic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1001778127 5:174344474-174344496 TGGAATGACCAGAAGGCAGATGG - Intergenic
1002261394 5:177996018-177996040 TGGCATACACAGAGGGAGAAGGG - Exonic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003752238 6:9072144-9072166 TGGAATTGACAGATTGAGGATGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004343421 6:14827274-14827296 TGGAATAAAGACAAAGAGGAAGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005507325 6:26481168-26481190 TAGTATAAAATGAAGGAGGAAGG - Intergenic
1006060767 6:31416880-31416902 TGGAAGCAAGAGAAGGACGAGGG + Intergenic
1006219462 6:32476269-32476291 TGGAAAAAACAGATAGAAGAGGG - Intergenic
1006597326 6:35203049-35203071 GGGAAGCAACAGAGGGAGGAAGG + Intergenic
1007474502 6:42109843-42109865 TGGAAGATACAGAGGTAGGAGGG + Intronic
1008589717 6:52981917-52981939 TGGAATTCTCAGAAGGAGAATGG + Intronic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1011144448 6:84197249-84197271 TGGAAAAAAAAAAAGGAGGTAGG + Intronic
1011617714 6:89212273-89212295 TGGAATGAACAGGATGGGGATGG - Intronic
1012524877 6:100165403-100165425 TGGAATAAAGAGCATGAGTAAGG - Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1013164265 6:107575563-107575585 TGGAACAAACAGAAGGGGTGGGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1014707168 6:124761863-124761885 TGGAAAAAACAGAAATAGGAAGG + Intronic
1015097768 6:129436495-129436517 TGTAATAAAAAAAAGGAGGGGGG - Intronic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016337064 6:143018434-143018456 TGGCATAAACAGAGAGAGGGAGG + Intergenic
1016379328 6:143458332-143458354 TGGAAAAAAAAGAGGGAAGAGGG - Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016434464 6:144021517-144021539 TGGAATAACTACATGGAGGAAGG + Intronic
1016626458 6:146175136-146175158 GGGAATGAACACAAGGAGGCAGG + Intronic
1016710142 6:147161693-147161715 AGGAAGAAAGAAAAGGAGGAGGG - Intergenic
1016830119 6:148425734-148425756 GGGAAAAAAAAAAAGGAGGAGGG - Intronic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017591624 6:155984358-155984380 TGAAATAAAAAGAAGGGAGATGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017922183 6:158882285-158882307 TGGAATTGACATAAGGAGAAAGG + Intronic
1018366560 6:163126389-163126411 TGAAATGAACAGAAGTGGGAAGG - Intronic
1018561544 6:165105523-165105545 TGGAAAACACAGAGAGAGGAGGG + Intergenic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018637714 6:165878903-165878925 TGGAACCACCAGAAGGAAGATGG + Intronic
1018691962 6:166353651-166353673 TGGAAGGAAAGGAAGGAGGAAGG - Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020579755 7:9981416-9981438 TGGAAAAAAAAAAAGGAGAAGGG + Intergenic
1020695692 7:11411257-11411279 TGGAATAAAAACAAGGATGTTGG - Exonic
1021324987 7:19255633-19255655 AGGAAGAAAAAGAGGGAGGAAGG - Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021613442 7:22479248-22479270 TGGAAGAAACAAAAGGAGATAGG + Intronic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022288297 7:28976247-28976269 TGGCATGTACAGAAGGAAGATGG + Intergenic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1023119163 7:36892205-36892227 TGGCACACACAGAGGGAGGAGGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023314415 7:38920591-38920613 TGCAATAAACAGACCCAGGATGG - Intronic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024106935 7:46099399-46099421 TGGATTAAAAAGAGGGAGAATGG + Intergenic
1024209138 7:47188977-47188999 TGGAATACACACAGGGAGGGAGG - Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028022230 7:85791422-85791444 TGGAGTATACAGAAGCAGGCAGG - Intergenic
1028341526 7:89726927-89726949 TGGAACAAAAAGATAGAGGAAGG + Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1030076264 7:105739555-105739577 TGGAGTGAAAAGATGGAGGAGGG + Intronic
1030300728 7:107971785-107971807 TGGAATAGAGAAAAAGAGGAAGG + Intronic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032016817 7:128385406-128385428 TGGAAAAAAATGAAGCAGGAGGG + Intergenic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034291019 7:149931660-149931682 TGTAATTAAAAGAAGGAAGAAGG + Intergenic
1034815166 7:154166113-154166135 TGTAATTAAAAGAAGGAAGAAGG - Intronic
1034920795 7:155079802-155079824 TGGACCAAACAGATGGAGAAGGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035956490 8:4085986-4086008 TGTAATTAAAAGAAGGAGCAAGG + Intronic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1036573330 8:10001267-10001289 TGGAACAAAAAGAATAAGGAAGG + Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037014485 8:13885717-13885739 TGGAATATAGAGAAGGGAGATGG + Intergenic
1037489366 8:19383153-19383175 TGGAACTATCAGAAGGAGAAGGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038483665 8:27918890-27918912 GGGAAGAAAGAGGAGGAGGAAGG + Intronic
1038512988 8:28158013-28158035 TGGAAGAAAGGAAAGGAGGAAGG - Intronic
1039042960 8:33425461-33425483 TGGAATAAACAGAAAAAAGGAGG + Intronic
1039309140 8:36297019-36297041 TGGAAGAAACAGAAAGATGTGGG + Intergenic
1039312126 8:36328120-36328142 TGGAATGGACAGAAGGAGTAAGG - Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1039391468 8:37184378-37184400 TGGCATTTAGAGAAGGAGGAAGG - Intergenic
1040447066 8:47506186-47506208 TGGAAGTAACACAGGGAGGAGGG + Intronic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041091889 8:54309833-54309855 TGAAATAAAAAGAAGAAGAAAGG - Intergenic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041524774 8:58792936-58792958 TGGAAGAAACAGAAAAAGAAGGG + Intergenic
1041772006 8:61481739-61481761 TGGAATCTACAGAGGGAGGCAGG - Intronic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042388282 8:68202961-68202983 TGGAACAAAAAGGAAGAGGAAGG - Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043021670 8:75009383-75009405 TCTAATAAACAGAAAGAGGCTGG - Intronic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1043843217 8:85133808-85133830 TGGCATAAACAGAGGGGGGTAGG - Intronic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044626784 8:94241868-94241890 TGGAATAAGGACAAGAAGGAAGG + Intergenic
1044890448 8:96829456-96829478 TGGAATTCACAGAATGAAGATGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045718666 8:105079655-105079677 TGGAAGAAAGAGAAAGAGGGAGG + Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046324075 8:112617551-112617573 TGGAATAAACAACAGAAGAAAGG - Intronic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1046485920 8:114888393-114888415 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1046543099 8:115612099-115612121 TGAAAAAAAGAGAAGGAGAAAGG + Intronic
1046638045 8:116694951-116694973 TGGGATAAACAGAGGAAGTATGG - Intronic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046842078 8:118870314-118870336 TGGAATATAGAGAATGAGAAGGG - Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047866649 8:129031639-129031661 TGGAACACCCAGAAGGAGAATGG - Intergenic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049106214 8:140615088-140615110 TGAAATAAACAAAAGCAGGCTGG + Intronic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050475912 9:6040944-6040966 AGGAAGGAAAAGAAGGAGGAAGG - Intergenic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051217263 9:14811763-14811785 TGAAATAAATTCAAGGAGGAGGG - Intronic
1051282427 9:15455636-15455658 TGTAATAAACATAAGATGGAAGG + Intronic
1051810970 9:21049151-21049173 TGGAATAAAAAGGTGGAGGAAGG - Intergenic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1051888235 9:21917117-21917139 TGCCATAAACTGAATGAGGAAGG + Intronic
1052573704 9:30264401-30264423 TGGAATAAACAGTGGTAGCAAGG - Intergenic
1052994647 9:34545427-34545449 TGGAAGAAAGGAAAGGAGGAGGG - Intergenic
1053069100 9:35090438-35090460 TGGAAGCAAGTGAAGGAGGAGGG + Intronic
1053599320 9:39594069-39594091 TGGAAGAGACAGAGGGAGGGTGG - Intergenic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1053857025 9:42348255-42348277 TGGAAGAGACAGAGGGAGGGTGG - Intergenic
1054254204 9:62748317-62748339 TGGAAGAGACAGAGGGAGGGTGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1057377691 9:94540349-94540371 TGGAGCAAAGAGTAGGAGGACGG - Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058397583 9:104572542-104572564 TGGAAATAACAGAAAGAAGAAGG + Intergenic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1060045494 9:120337026-120337048 TGGAAGAAAGAAAAGAAGGACGG + Intergenic
1060490099 9:124077684-124077706 TGGCAAAAAAGGAAGGAGGAGGG - Intergenic
1060812500 9:126617836-126617858 TGGAAAAAATAGAATGAGGGTGG - Intronic
1061290044 9:129645516-129645538 TGGCATAGACAGCAGGAAGAAGG - Intergenic
1061731423 9:132617315-132617337 TGGAATAAGTAGAAGGAGATGGG - Intronic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203491488 Un_GL000224v1:109744-109766 TGTAATAAACAGGAAGAGCAGGG - Intergenic
1203364405 Un_KI270442v1:244099-244121 AGCAATAAACAGAGAGAGGAAGG + Intergenic
1203504112 Un_KI270741v1:51615-51637 TGTAATAAACAGGAAGAGCAGGG - Intergenic
1185627294 X:1491938-1491960 TGGAATGGACAGAAGGCGGCAGG + Intronic
1185861409 X:3582961-3582983 TGGAACACAGGGAAGGAGGAGGG + Intergenic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186240383 X:7559199-7559221 TGGAAGGAAGAGAAGAAGGAAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187370792 X:18704254-18704276 TGGAAAAAATAGCATGAGGATGG + Intronic
1187675937 X:21716636-21716658 TGGAAGATAGAAAAGGAGGAAGG - Intronic
1187777620 X:22780274-22780296 TGGAATAAAGAAAAGAAAGAGGG + Intergenic
1187810460 X:23170890-23170912 TGGCATAAAGGGAAGGAGAAGGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187960536 X:24563050-24563072 TGGAAGAAAAAAAAGGAAGAAGG - Intronic
1188388731 X:29593198-29593220 TGGGATAAAGTGGAGGAGGAGGG - Intronic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1189128384 X:38472584-38472606 TGGAAGAAAGAGAAGAAGGAAGG - Intronic
1189364899 X:40380730-40380752 AGGAAGGAAAAGAAGGAGGAAGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189757062 X:44282793-44282815 TGGAAGAAACTGAGGGTGGAGGG + Intronic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1192115048 X:68402070-68402092 TGGAATGAACCGAAGGAGAAAGG + Intronic
1192341109 X:70264163-70264185 TGGAACAAACTGGAGGAGTAGGG - Intergenic
1193484411 X:82069088-82069110 TGGAATAAAAACAAAGAGGTTGG + Intergenic
1194213681 X:91100839-91100861 AGGAATGAAAAGAAGGAGTAGGG + Intergenic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1194631240 X:96287122-96287144 TGAAAGAAAGAGATGGAGGAAGG + Intergenic
1194734925 X:97500931-97500953 TGGAATAAAAAGCAAAAGGAAGG - Intronic
1195309405 X:103616246-103616268 GGGAAGAAAAAAAAGGAGGATGG - Intronic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1196808524 X:119609872-119609894 TGCAATAGAGAGGAGGAGGATGG - Intergenic
1197140251 X:123109992-123110014 TGGAAAAATCAAAAGAAGGAAGG - Intergenic
1197821816 X:130548924-130548946 TGGAAGCAACAGAAGGAGTAAGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198487704 X:137104902-137104924 TGGAAGAAACTGAAGCGGGAAGG - Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1200050883 X:153431017-153431039 TGCATTAGACAGAAGGAGGAAGG + Intergenic
1200726757 Y:6680276-6680298 TGAAATATACTGAAGAAGGAAGG - Intergenic
1200727909 Y:6696052-6696074 TGAAATATACTGAAGAAGGAAGG - Intergenic
1201416667 Y:13754103-13754125 TGTAATAATTAGAAGGAAGATGG + Intergenic