ID: 1122078323

View in Genome Browser
Species Human (GRCh38)
Location 14:99249676-99249698
Sequence GTAAATAACTTAACATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 1, 2: 26, 3: 126, 4: 747}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122078313_1122078323 23 Left 1122078313 14:99249630-99249652 CCGGAGTTGACACCCTGGGACCC 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747
1122078320_1122078323 -6 Left 1122078320 14:99249659-99249681 CCGCTGTGTGACCTTGGGTAAAT 0: 1
1: 6
2: 46
3: 193
4: 585
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747
1122078316_1122078323 3 Left 1122078316 14:99249650-99249672 CCCTACTCACCGCTGTGTGACCT 0: 1
1: 0
2: 3
3: 14
4: 131
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747
1122078317_1122078323 2 Left 1122078317 14:99249651-99249673 CCTACTCACCGCTGTGTGACCTT 0: 1
1: 1
2: 3
3: 35
4: 311
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747
1122078315_1122078323 10 Left 1122078315 14:99249643-99249665 CCTGGGACCCTACTCACCGCTGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747
1122078314_1122078323 11 Left 1122078314 14:99249642-99249664 CCCTGGGACCCTACTCACCGCTG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG 0: 1
1: 1
2: 26
3: 126
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122078323 Original CRISPR GTAAATAACTTAACATCTCT GGG Intronic
900790786 1:4678965-4678987 GCAAGTTACTGAACATCTCTGGG - Intronic
901795767 1:11678619-11678641 GCAAATTCCTTAACTTCTCTGGG + Intronic
902124673 1:14198851-14198873 GTAACTTATTTAACCTCTCTGGG - Intergenic
902150214 1:14436804-14436826 CCAAGTAACTTAACATCTCAGGG - Intergenic
902175842 1:14650078-14650100 GAAAATTACTAAACTTCTCTGGG - Intronic
902183744 1:14709892-14709914 GTAAGTATCTTAACCTCTCTGGG - Intronic
902727687 1:18348133-18348155 GCAAGTTACTTAACCTCTCTGGG - Intronic
902871811 1:19318191-19318213 GCAAATTGCTTAACTTCTCTGGG - Intronic
903019392 1:20383471-20383493 GCAAATTACTTAACCTCTCTGGG - Intergenic
903303935 1:22399496-22399518 GCAAGTGACTTAACCTCTCTGGG - Intergenic
903343119 1:22667222-22667244 GCTAATTACTTAACCTCTCTGGG + Intergenic
903367857 1:22816021-22816043 GCCAATTACTTAACCTCTCTGGG + Intronic
903463018 1:23532137-23532159 GTAAATGTTTGAACATCTCTAGG + Intergenic
903496714 1:23773440-23773462 GCAAATTGCTTAACCTCTCTAGG - Intergenic
903518575 1:23929707-23929729 GCAAGTTACTTAACATCTCTGGG - Intergenic
903632138 1:24783249-24783271 GCAAGTCACTTAACCTCTCTGGG - Intronic
903639579 1:24849121-24849143 GCAAATTATTTAACCTCTCTAGG - Intergenic
904051838 1:27644468-27644490 GCAAATGTCTTAACAACTCTGGG + Intergenic
904256055 1:29255484-29255506 GCACATTACTTAACCTCTCTGGG + Intronic
904785416 1:32978932-32978954 GTAAGTCACTTCACCTCTCTGGG - Intergenic
905676726 1:39831304-39831326 GTGACTTACTTAACCTCTCTGGG + Intergenic
905743264 1:40390771-40390793 GCAAATGACTTGACCTCTCTAGG + Intronic
905791134 1:40790182-40790204 GCAAGTTACTTAACCTCTCTGGG + Intronic
906582893 1:46951018-46951040 GAAAGTCACTTAACATCTCTGGG - Intergenic
906673079 1:47673375-47673397 GAAAACAACTTAAAATATCTAGG - Intergenic
906798694 1:48717843-48717865 GCAAATAATCTAACCTCTCTGGG + Intronic
907188453 1:52629865-52629887 GCAAGTTACTTAACCTCTCTGGG + Intergenic
907271270 1:53292763-53292785 ACATGTAACTTAACATCTCTGGG - Intronic
907307496 1:53521468-53521490 ACAAATAACATAACCTCTCTGGG + Intronic
907597888 1:55736390-55736412 GCAAATCACTTAACATTTCTGGG + Intergenic
907813607 1:57896618-57896640 GCAAGTTGCTTAACATCTCTGGG + Intronic
907951413 1:59187397-59187419 GTAAGTTACTTAATCTCTCTGGG + Intergenic
908104197 1:60824698-60824720 GAAAATTACGTAACTTCTCTAGG - Intergenic
908317122 1:62943700-62943722 GAAAATGACTTACCCTCTCTGGG - Intergenic
908335780 1:63121467-63121489 ATAAATCACTTAAACTCTCTGGG + Intergenic
908395582 1:63722431-63722453 GCAAGTCACTTAACATCTCTGGG + Intergenic
908466020 1:64396443-64396465 ATAAATAATTTAAAATCTTTGGG - Intergenic
908573300 1:65432524-65432546 CTAAACCACTTAACCTCTCTGGG + Exonic
909139247 1:71842983-71843005 TTAAAAAACTTAACTTCTTTGGG + Intronic
909506635 1:76398134-76398156 GGAAATCAATTAACATCTCGTGG - Intronic
909666860 1:78143816-78143838 GCAAATAATTTAATTTCTCTGGG - Intergenic
910172540 1:84393070-84393092 GTAGCTCACTTAACATCTCTGGG - Intergenic
910316630 1:85892113-85892135 ACAAATTACTTAACTTCTCTGGG - Intronic
910730803 1:90393727-90393749 GAAAATGACTTAATCTCTCTGGG + Intergenic
910987640 1:93021296-93021318 GGAAATTATTTAACTTCTCTGGG - Intergenic
911145552 1:94549254-94549276 GCAAATTATTTAACCTCTCTGGG - Intergenic
912149409 1:106839154-106839176 GCAAGTCACTTAACTTCTCTGGG - Intergenic
913485616 1:119330249-119330271 GCAAGGAACTTAATATCTCTGGG + Intergenic
913965176 1:143370854-143370876 GCAAATTACTTAACTTCTCTGGG + Intergenic
914059553 1:144196456-144196478 GCAAATTACTTAACTTCTCTGGG + Intergenic
914119597 1:144769915-144769937 GCAAATTACTTAACTTCTCTGGG - Intergenic
914881394 1:151549648-151549670 GCAAATCACTTAATCTCTCTGGG - Intronic
914925456 1:151882502-151882524 GCAAATTACCTAACCTCTCTGGG - Intronic
915087620 1:153398817-153398839 GGAAATTACTTATCCTCTCTGGG - Intergenic
915273267 1:154770662-154770684 GCAAGTTACTTAACCTCTCTGGG - Intronic
915710633 1:157894779-157894801 GCAAATTGCTTAACCTCTCTGGG - Intronic
915936846 1:160094735-160094757 GCAAATCACTTAACCTCTTTGGG + Intronic
916178852 1:162066632-162066654 GCAAATTACTTAATCTCTCTGGG + Intergenic
916447062 1:164882147-164882169 GAAAATCACTTAATATCTCTGGG - Intronic
916725027 1:167515991-167516013 GCAAGTTACTTAACCTCTCTGGG - Intronic
916745102 1:167679224-167679246 GTAACTTACTTAGCAACTCTAGG + Intronic
916995205 1:170289485-170289507 ATATATAAATTAACCTCTCTCGG + Intergenic
917088102 1:171323977-171323999 ATAAGTTACTTAACTTCTCTAGG + Intronic
917135253 1:171782906-171782928 GTAGAAAACTTAACATTTGTGGG + Intronic
918366049 1:183808794-183808816 GCAAACAATTTAACCTCTCTGGG - Intronic
918743473 1:188167402-188167424 AAAAATAACTGAACATTTCTTGG + Intergenic
919785221 1:201254378-201254400 GTAAGTGACTTAACATCTGGAGG + Intergenic
920214516 1:204352509-204352531 GAAAATTACTTAACCTCTCTGGG - Intronic
920872917 1:209808913-209808935 GTAAATCACTTGACCTCGCTGGG - Intergenic
921498986 1:215877121-215877143 AAAAATCACTTAACTTCTCTGGG - Intronic
922167498 1:223128242-223128264 TTAAGTTACTTAACATCTCCGGG - Intronic
922441173 1:225656193-225656215 GCAAGTTACTTAACCTCTCTGGG - Intergenic
923195651 1:231664163-231664185 GCAAATTACTTAATGTCTCTGGG - Intronic
923348531 1:233080965-233080987 TTAAATAACTTCACACATCTGGG - Intronic
924021268 1:239786459-239786481 GCAAATGACTTACCCTCTCTCGG - Intronic
924090318 1:240494281-240494303 GTAAATGACTCAACTTCTGTGGG - Intronic
924149475 1:241113694-241113716 GAAAATAATTTAGCCTCTCTGGG + Intronic
1063057394 10:2520905-2520927 GTAAAATACTTAATATTTCTTGG + Intergenic
1063622672 10:7663736-7663758 GCAAGTCACTTAACCTCTCTGGG - Intronic
1064198857 10:13267692-13267714 GTAAATTACTTGACTTCTCTGGG - Intergenic
1064387245 10:14907226-14907248 TTAAGTGACTTAACATCTTTGGG + Intronic
1064765519 10:18666950-18666972 GTAAATAAATTGATAGCTCTAGG + Intronic
1065012028 10:21429345-21429367 GAAAATAATTTAAAATGTCTAGG - Intergenic
1065428935 10:25633876-25633898 ATAATTGACTTAACCTCTCTGGG - Intergenic
1066138097 10:32472042-32472064 GTATATTACTTAACCTCTATTGG - Intronic
1066232191 10:33446964-33446986 GTCAGTCACTTAACTTCTCTAGG - Intergenic
1066588906 10:36970724-36970746 GCAACTAACTCAACCTCTCTAGG - Intergenic
1068002737 10:51355289-51355311 GTAAGTTACTTAACATTTCCAGG - Intronic
1068037090 10:51774154-51774176 GTAAGTAAATTAAGCTCTCTAGG - Intronic
1068517233 10:58039578-58039600 GCAATTTACTTAGCATCTCTGGG + Intergenic
1068666543 10:59682043-59682065 GCAAGTCACTTAACCTCTCTAGG - Intronic
1068920833 10:62482291-62482313 GCAACTTACTTAACTTCTCTGGG + Intronic
1068923469 10:62510775-62510797 ATAAAAAACTGAACCTCTCTAGG - Intronic
1069294793 10:66830430-66830452 GTAAATAACTTAACCTCTGTCGG - Intronic
1069528384 10:69194924-69194946 GCAAGTAACTTAATTTCTCTGGG + Intronic
1070175744 10:73967700-73967722 GCAAATGACTTAACCTCTCTGGG - Intergenic
1070321414 10:75357676-75357698 GCAAATTACTTAACATCTCTGGG - Intergenic
1070385772 10:75923021-75923043 GAAAGTCACTTAACCTCTCTGGG - Intronic
1070386099 10:75926008-75926030 GCAAGTTACTTAACCTCTCTGGG - Intronic
1070645815 10:78201574-78201596 GCAAGTCACTTAACCTCTCTGGG + Intergenic
1070666834 10:78350908-78350930 GTAAATTACTTCACCTTTCTGGG + Intergenic
1070825839 10:79390244-79390266 GCAAATCACTTAACTTCTCTGGG + Intronic
1071992969 10:91118158-91118180 GCACATCACTTAACCTCTCTGGG - Intergenic
1072411411 10:95205707-95205729 GAAAATAAATTAACATTACTTGG + Intronic
1073170461 10:101503074-101503096 GTAAATTAATTAACTTCTCTGGG - Intronic
1073328074 10:102653977-102653999 ACAAATTACTTAACCTCTCTAGG + Intronic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1073414143 10:103367478-103367500 GTAAGTTATTTAACCTCTCTTGG + Intergenic
1074142141 10:110682482-110682504 GTAAATAAATGAACATGGCTGGG + Intronic
1075768456 10:124913807-124913829 TTAAGTCACTTAACATCTTTAGG + Intergenic
1076480279 10:130780297-130780319 GTGACTAACTTAGCACCTCTTGG - Intergenic
1076866821 10:133170607-133170629 ATAGATAACTTAAAATGTCTTGG - Intronic
1077363941 11:2153983-2154005 GAAAGTCACTTAGCATCTCTGGG - Intronic
1077531762 11:3100392-3100414 GTGAGTCACTTAACCTCTCTGGG + Intronic
1077640633 11:3878364-3878386 GTAAGTTGCTTAACCTCTCTGGG - Intronic
1077806083 11:5592409-5592431 GCAAGTTACTTAACCTCTCTTGG - Intronic
1078156371 11:8803461-8803483 GGAAGTAACTTGACTTCTCTAGG - Intronic
1078838758 11:15057756-15057778 ATAAATAACTTAACACTCCTTGG + Intronic
1078858109 11:15222930-15222952 GAAAGTAACTTAACCCCTCTAGG - Intronic
1079110799 11:17604058-17604080 GTAAATCACTTAATCTCTCTGGG - Intronic
1079573832 11:21978400-21978422 CTAAGTTACTTAACAGCTCTGGG + Intergenic
1079626340 11:22621183-22621205 GCAAATAACTTCAGATTTCTAGG + Intergenic
1079910610 11:26305411-26305433 TTAAATAAGTTAACAGATCTGGG - Intergenic
1079914039 11:26346130-26346152 GCAACTTACTTAACATCTCAGGG - Intronic
1079954363 11:26844000-26844022 GGAAATAAATTAAGATCTTTGGG + Intergenic
1079983204 11:27173780-27173802 GTGAATCACTTCACGTCTCTGGG + Intergenic
1080039095 11:27740058-27740080 ATACATTACTTAACCTCTCTGGG - Intergenic
1080247968 11:30200871-30200893 GCACATCACTTAACCTCTCTTGG - Intergenic
1081426234 11:42929083-42929105 GTAAATAAATAAACATATATTGG - Intergenic
1081576896 11:44324358-44324380 GTGAGTTACTTAACCTCTCTGGG + Intergenic
1081649188 11:44812239-44812261 GCAAATGACTTAGCCTCTCTGGG + Intronic
1081655166 11:44852371-44852393 GAAAATGCCTTAACTTCTCTGGG - Intronic
1081855853 11:46303210-46303232 GCAAGTTACTTAACCTCTCTAGG + Intronic
1081980847 11:47265988-47266010 GTAAGTTATTTAACCTCTCTGGG - Intronic
1081984500 11:47291762-47291784 GCAAATAACTTCACCTCTCAGGG + Intronic
1082784737 11:57310690-57310712 GCAAATCACTTAACCACTCTGGG + Intronic
1083153289 11:60807242-60807264 GGAAATTACTTAACTCCTCTGGG - Intergenic
1083335948 11:61921808-61921830 GCAAGTCACTTAACCTCTCTGGG + Intergenic
1083395662 11:62390084-62390106 GTAGACTACTTCACATCTCTTGG - Intronic
1083676812 11:64330615-64330637 GCAAGTGACTTAACCTCTCTGGG + Intergenic
1084118372 11:67055022-67055044 GTCAACAACTTAGCCTCTCTGGG + Intergenic
1085362122 11:75898800-75898822 GGAAATCTCTTAACTTCTCTGGG - Intronic
1085668668 11:78440429-78440451 CTAAGTTAGTTAACATCTCTGGG + Intronic
1085809375 11:79666815-79666837 GTAAATCTCTTAACTCCTCTTGG + Intergenic
1085899169 11:80677211-80677233 GCAACTAACTCAACCTCTCTAGG + Intergenic
1085999135 11:81957391-81957413 GTAAATAACTTATTAAATCTAGG - Intergenic
1086031219 11:82358429-82358451 TTAAATAACTTAACACCACATGG - Intergenic
1086095445 11:83045872-83045894 GTAAGTAATTTAAAATCTCTGGG + Intronic
1086189161 11:84057827-84057849 GCAAATTGCTTAACCTCTCTGGG - Intronic
1086279244 11:85166778-85166800 TTAAACAACTTAATATCTATGGG - Intronic
1086407086 11:86507685-86507707 GTATAAAAATTAACATCACTAGG + Intronic
1086448761 11:86895280-86895302 GTGAGTCACTTAACTTCTCTGGG + Intronic
1086453011 11:86935712-86935734 GTAAGTTACTTAACCTCTCTGGG - Intronic
1086530481 11:87779083-87779105 TTAAATAACTTAATCTCTCCAGG + Intergenic
1086615442 11:88812436-88812458 GCAAATAATTTAACATTTCCAGG - Intronic
1086735807 11:90304072-90304094 GTAAATAAATTAACAGCCTTGGG + Intergenic
1086794721 11:91085370-91085392 GTAAATCATTTAACAACTGTTGG + Intergenic
1087522545 11:99259728-99259750 GAAAATAATTTCACATTTCTAGG + Intronic
1088350573 11:108882861-108882883 GCAAATCATTTAAAATCTCTGGG + Intronic
1088615306 11:111620865-111620887 GCAAATCACTAAACCTCTCTGGG + Intronic
1088915656 11:114225951-114225973 GCAAATCACTTAGTATCTCTGGG - Intronic
1089040693 11:115446571-115446593 GTGAGTTACTTAACCTCTCTGGG - Intronic
1089299609 11:117490669-117490691 ATAAATCACTGAACCTCTCTGGG - Intronic
1089310149 11:117552523-117552545 GTAAATCACTTAATCTCTCTGGG + Intronic
1089660500 11:119982306-119982328 GTAGGTCACTTAACTTCTCTGGG + Intergenic
1090034388 11:123235989-123236011 GCAAATTGCTTAACATCTCCAGG - Intergenic
1090380020 11:126319862-126319884 GCAAATTACTCAACATCTCTGGG + Intronic
1090533612 11:127616660-127616682 GTAAAGAAATGAACATTTCTTGG + Intergenic
1090552655 11:127840218-127840240 GTGACTGACTAAACATCTCTTGG + Intergenic
1091090673 11:132768654-132768676 TTAAATGACTTACCTTCTCTTGG - Intronic
1091463956 12:667560-667582 GCAAGTCACTTAACTTCTCTGGG + Intergenic
1091678174 12:2506658-2506680 ACAAATCACTTAACATCTCTGGG - Intronic
1092005088 12:5062417-5062439 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1092743984 12:11656215-11656237 ATACATCACTTAACCTCTCTGGG - Intronic
1092834975 12:12478634-12478656 GTGAATAAATAATCATCTCTTGG - Intronic
1092985430 12:13840479-13840501 GACAACAACTCAACATCTCTGGG + Intronic
1093316864 12:17663187-17663209 GTAAATGAATTAAAAACTCTGGG - Intergenic
1093543382 12:20315738-20315760 GTAAAGTAATTAACTTCTCTGGG - Intergenic
1093593473 12:20934528-20934550 GTAAATAAAATAAAATATCTAGG - Intergenic
1093885220 12:24451732-24451754 GCAAGTAACTAAACCTCTCTGGG + Intergenic
1094174883 12:27531192-27531214 GCAAGTAACTTAACCTCTCTGGG + Intronic
1094334733 12:29336259-29336281 GTAATTAACTTAGTATCTCAAGG + Intronic
1096010696 12:48211936-48211958 GAGAATAACTGAACTTCTCTGGG + Intergenic
1096489404 12:52005632-52005654 GCAAATTACTTATCTTCTCTGGG + Intergenic
1096975090 12:55695185-55695207 CCAAGTAACTTAACCTCTCTAGG + Intronic
1097287239 12:57887795-57887817 GAAAGTTACTTAACCTCTCTGGG - Intergenic
1097474798 12:60039959-60039981 ATAACTAAATCAACATCTCTGGG - Intergenic
1097759573 12:63446970-63446992 GTTAATAACTGAACTCCTCTTGG - Intergenic
1097880070 12:64678898-64678920 GCAAGTTACTTAACCTCTCTGGG - Intronic
1098133982 12:67382104-67382126 GAAAATTACTTAACCTCCCTGGG - Intergenic
1098211105 12:68166474-68166496 GTGCATTACTTAACTTCTCTGGG + Intergenic
1099584418 12:84498766-84498788 GTAAATAACTAAACATCACTGGG - Intergenic
1100026130 12:90130279-90130301 GTAAGTCACTTAACCTCTGTTGG + Intergenic
1100237695 12:92677511-92677533 GGCAATAACTGAACTTCTCTAGG + Intergenic
1100247746 12:92780532-92780554 GCAAATTACTTACCCTCTCTTGG + Intronic
1100860097 12:98795834-98795856 GCAAGTGACTTAACTTCTCTTGG + Intronic
1100934271 12:99645523-99645545 GTTAATAATTTAACCTCTCTGGG - Intronic
1100953108 12:99875003-99875025 CTAAATAACTTAACCTCTCCTGG + Intronic
1100979218 12:100151778-100151800 GTAAATAACTAAAGAGCTCCAGG + Intergenic
1101031001 12:100660103-100660125 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1101041359 12:100759126-100759148 GTAAAACACCTACCATCTCTAGG - Intronic
1101081206 12:101186632-101186654 GTTATTCACTTAACTTCTCTAGG + Intronic
1101132240 12:101700841-101700863 GAAAGTCACTTGACATCTCTGGG - Intronic
1101231027 12:102741267-102741289 GTTAATAAATTAATTTCTCTTGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101526117 12:105532738-105532760 TTAAATATCTGTACATCTCTTGG - Intergenic
1101594459 12:106151632-106151654 GTAACTTGCTTAACTTCTCTGGG + Intergenic
1101794186 12:107957717-107957739 ATAAGTCACTTAACCTCTCTGGG - Intergenic
1101813353 12:108127023-108127045 GTAAGTTAATTAACCTCTCTGGG - Intergenic
1101990692 12:109482124-109482146 GTAATTAATTTAATACCTCTAGG + Intronic
1102011163 12:109619424-109619446 GCAAATCACTTAACTTCTCTGGG - Intergenic
1102352882 12:112207536-112207558 GAAAATTACTTAACATCTCTGGG - Intronic
1102432186 12:112892200-112892222 GCTCATAGCTTAACATCTCTAGG + Intronic
1102737054 12:115171567-115171589 GTGATTGACTTAACTTCTCTGGG - Intergenic
1103125798 12:118421352-118421374 GAAAGTCATTTAACATCTCTGGG - Intergenic
1103217814 12:119216291-119216313 GTAACTGACATAACCTCTCTGGG + Intronic
1103602791 12:122064683-122064705 GCAAGTATCTTAACCTCTCTGGG + Intergenic
1104589988 12:130076344-130076366 GCAAGTCACTTAACCTCTCTAGG - Intergenic
1104914023 12:132255294-132255316 GTAAAATACTTAACTTCTTTAGG - Intronic
1105050726 12:133048470-133048492 GAAAGTTACTTAACCTCTCTTGG - Intronic
1105877278 13:24569203-24569225 GAAAATAACTATACATCTGTGGG - Intergenic
1105907765 13:24830590-24830612 ATAAATAAATTACCTTCTCTGGG - Exonic
1106235162 13:27855285-27855307 GTAAGTTACTTAACATCTCTGGG - Intergenic
1106241210 13:27915198-27915220 GCAAGTAACTTACCATCACTGGG + Intergenic
1106532884 13:30610547-30610569 GCAAATTATTTAACCTCTCTGGG - Intronic
1106720481 13:32430061-32430083 GTATGTAACTTAAACTCTCTAGG - Intergenic
1106749070 13:32739246-32739268 TTAAATATCTTACCATCTCCTGG + Intronic
1107492770 13:40897907-40897929 GCAAATTATTTAACATCTCTGGG + Intergenic
1107695961 13:43000136-43000158 GCAAATTACTGAACATCTCAGGG + Intergenic
1107733157 13:43368853-43368875 GCAAATCACTTCACTTCTCTGGG - Intronic
1108186544 13:47893595-47893617 GTTAAAAACTTAAAGTCTCTAGG + Intergenic
1108221958 13:48244032-48244054 ATAAATAATTTTACTTCTCTGGG + Intronic
1108323390 13:49307318-49307340 GTAGGTAACTTAACTTCACTTGG - Intergenic
1108333681 13:49416663-49416685 ACAAATTACTTAACCTCTCTGGG + Intronic
1108669609 13:52671590-52671612 GCAAATTATTGAACATCTCTGGG - Intronic
1108693341 13:52880083-52880105 GCAAATTATTTAACTTCTCTGGG - Intergenic
1108747057 13:53406653-53406675 GAAAGTTACTTAACCTCTCTGGG - Intergenic
1108862077 13:54873178-54873200 TAAAATTACTTAACATCTCCAGG + Intergenic
1109297112 13:60547492-60547514 GTAAGTTACCTAATATCTCTGGG + Intronic
1109298501 13:60564586-60564608 GAAAATCACTTCACCTCTCTTGG + Intronic
1109857051 13:68144230-68144252 AAAAATAATTTAACATATCTGGG + Intergenic
1110304378 13:73968102-73968124 ATAAGTCACTTAACATCTTTGGG + Intronic
1110665996 13:78118121-78118143 GTAAAGTATTTAACCTCTCTGGG - Intergenic
1111255499 13:85662268-85662290 GGAATTAATTTAACATCTCCAGG - Intergenic
1111352386 13:87047944-87047966 GAAAATAAATTAAGATCTCTGGG - Intergenic
1111480569 13:88820180-88820202 GTAAATTACTTAACTTCTCCAGG - Intergenic
1111822902 13:93234757-93234779 GTAATTCAATTAACATTTCTGGG - Intronic
1111935804 13:94556029-94556051 TTAAATAAATTAACTTCTTTTGG - Intergenic
1112225334 13:97533887-97533909 GCAAATTACTTAACCTCTCTGGG + Intergenic
1112928343 13:104705103-104705125 GCAAATATCTTCATATCTCTAGG + Intergenic
1113019939 13:105873657-105873679 GTAAATAACATAGCATCCATAGG + Intergenic
1113162898 13:107402719-107402741 GCAAAGAATTTAACCTCTCTTGG + Intronic
1113719073 13:112539246-112539268 GCAAATACCTTCACCTCTCTGGG - Intronic
1114273718 14:21122329-21122351 CTAAAGATCTCAACATCTCTGGG - Intergenic
1115274077 14:31587111-31587133 TTAAATAAATCAAAATCTCTGGG + Intronic
1115524310 14:34264272-34264294 GTTAATTACATAACCTCTCTGGG + Intronic
1115602108 14:34965124-34965146 GCAAACCACTTAACACCTCTAGG - Intergenic
1115677257 14:35691163-35691185 TAAAGTAACTTAACCTCTCTGGG - Intronic
1116536135 14:46033124-46033146 GTAAATCATTTAACTTTTCTAGG + Intergenic
1117331798 14:54719728-54719750 AGAAATAGCTTAACCTCTCTTGG + Intronic
1117495112 14:56294910-56294932 GTCAACGACTTAACCTCTCTGGG - Intronic
1118368594 14:65116625-65116647 GTAAGTCACTTAACATCTCTGGG - Intergenic
1118418964 14:65577705-65577727 ATAAATCACTTAACCTCTTTGGG + Intronic
1118564659 14:67126233-67126255 GCAAGTTACTTAATATCTCTGGG - Intronic
1119071133 14:71585559-71585581 GGAAATAACTTCACATATCCTGG + Intronic
1119163169 14:72470358-72470380 GAAAATAACTGGAAATCTCTTGG - Intronic
1119189172 14:72668269-72668291 TTAACTCACTTAACCTCTCTGGG + Intronic
1119534867 14:75394824-75394846 GTAAATTACTTACCATCTCTGGG + Intergenic
1119670546 14:76514955-76514977 GTCAGTCACTTAACCTCTCTGGG + Intergenic
1120718739 14:87868052-87868074 GTAAATAACTTGGCATTTCTAGG - Intronic
1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG + Intronic
1124202278 15:27688673-27688695 GCAAGTTACTTAACTTCTCTAGG - Intergenic
1124936565 15:34178070-34178092 GTTAGTTACTTGACATCTCTGGG - Intronic
1125001091 15:34770619-34770641 TTAAATTACTTAACTTTTCTGGG + Intergenic
1125422090 15:39514052-39514074 GCAAGTAACTTAATATCACTTGG - Intergenic
1125695563 15:41634373-41634395 GCAAATCATTTAACCTCTCTGGG - Intronic
1126053787 15:44711179-44711201 GCAAGTCACTTAGCATCTCTGGG + Intronic
1126175897 15:45735361-45735383 GTAAGTTACTTAAAATCTCTAGG + Intergenic
1126543913 15:49852112-49852134 GAAAGTTACTTAACCTCTCTGGG + Intergenic
1126672536 15:51129430-51129452 GTAAGTAACTTAATTTCTCTAGG - Intergenic
1126950470 15:53874793-53874815 GTAAATAATTTAAAAAATCTTGG + Intergenic
1127257678 15:57305936-57305958 GCAAGTTACTTAACTTCTCTGGG + Intergenic
1127424638 15:58843449-58843471 TCAAATTACTTAACATCTCTAGG - Intronic
1127615661 15:60682954-60682976 GCAAATAATTTAGCTTCTCTGGG + Intronic
1128153069 15:65375671-65375693 GCAAGTCACTTGACATCTCTGGG - Intronic
1128333874 15:66773803-66773825 GCAAGTCACTTAACTTCTCTGGG + Intronic
1128369430 15:67029551-67029573 GCAAATGACTTCACCTCTCTGGG - Intergenic
1128564571 15:68692166-68692188 GCAAGTAGCTTAACCTCTCTGGG + Intronic
1128584741 15:68838705-68838727 GTAAATAAATTACCATATATTGG - Intronic
1128814549 15:70598145-70598167 GCAAGTAACTTAACCTCTCTTGG + Intergenic
1129623015 15:77166651-77166673 GCAAGTAACTTAATCTCTCTGGG - Intronic
1129788935 15:78327847-78327869 GTAAGTCACTTAACATCTTTGGG + Intergenic
1129930754 15:79408705-79408727 ATAAATCACTTGACCTCTCTAGG + Intronic
1130084284 15:80764289-80764311 GCAAATCTCTTAACAGCTCTGGG + Intergenic
1130354345 15:83116455-83116477 ATAAGTCACTTAACCTCTCTGGG - Intronic
1130408620 15:83625173-83625195 GTAAATAACACAGCTTCTCTGGG - Intergenic
1130688639 15:86061005-86061027 GCAAATGACTTAACCTCTCTGGG + Intergenic
1130695922 15:86131513-86131535 GTAAATTATTCAACTTCTCTTGG + Intergenic
1130986618 15:88848770-88848792 GCAAGTCACTTAACCTCTCTAGG + Intronic
1131816718 15:96229071-96229093 GAAAATAACTCAAACTCTCTAGG + Intergenic
1133302128 16:4788732-4788754 TTAAACAAGTTAACATCTTTGGG - Exonic
1133309573 16:4835462-4835484 TTAAATAGATTAACATTTCTTGG - Intronic
1133760766 16:8796814-8796836 GTAAATATCTTACCCTCTCTGGG - Intronic
1134036821 16:11037351-11037373 GGAAACAACATAACAACTCTGGG + Intronic
1134104057 16:11472607-11472629 ACAAATTACTTAACCTCTCTGGG + Intronic
1134759277 16:16699175-16699197 GAAAATTACTCATCATCTCTAGG + Intergenic
1134852970 16:17496949-17496971 GTGTATAATTTAACAACTCTTGG + Intergenic
1134986794 16:18660008-18660030 GAAAATTACTCATCATCTCTAGG - Intergenic
1135079134 16:19419131-19419153 GTGAGTTACTTAACCTCTCTGGG + Intronic
1135090929 16:19516327-19516349 GTAAATAATTTAACTTTTCTGGG + Intronic
1135155314 16:20047819-20047841 GCAATTTACTTAACCTCTCTGGG + Intronic
1135610534 16:23862716-23862738 GGAAATGACTTCACCTCTCTGGG - Intronic
1135823701 16:25707426-25707448 GGAAATAACATAATATCTATAGG + Intronic
1136414301 16:30094402-30094424 GCAAGTTACCTAACATCTCTGGG + Intronic
1137564327 16:49523950-49523972 GTAAGTCACTTAACCTCTCTGGG + Intronic
1138066958 16:53952171-53952193 GTAAATTCCCTAACCTCTCTGGG - Intronic
1138130397 16:54474608-54474630 GTAAATCACTTAACTTCTCTGGG + Intergenic
1138222862 16:55267716-55267738 ACAAACTACTTAACATCTCTGGG - Intergenic
1138828063 16:60345026-60345048 GTAAATCTCTCAACTTCTCTGGG + Intergenic
1139086234 16:63589672-63589694 GCATATCACTTAACATCTTTAGG - Intergenic
1140132075 16:72171710-72171732 GTAAGTCACTTAGCCTCTCTGGG - Intronic
1140263422 16:73400154-73400176 GGCAATCACTTAACCTCTCTGGG - Intergenic
1140302374 16:73771014-73771036 GCAAGTCACTTCACATCTCTGGG + Intergenic
1140639177 16:76951734-76951756 GTAAATCACTAAATACCTCTTGG + Intergenic
1140931674 16:79633779-79633801 GGAAATGAATTAACCTCTCTGGG - Intergenic
1140935560 16:79666416-79666438 GTAACCAACTTAAGTTCTCTTGG + Intergenic
1141141932 16:81502127-81502149 GTACGTTACTTAACCTCTCTGGG - Intronic
1141431517 16:83972638-83972660 GCAAATTGCTTAACCTCTCTGGG - Intronic
1141613203 16:85195457-85195479 GCAAGTGACTTAACCTCTCTGGG - Intergenic
1141768780 16:86076026-86076048 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1141768993 16:86077439-86077461 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1141772462 16:86098866-86098888 GTAAGTCACTTAACCTTTCTGGG + Intergenic
1142706646 17:1699371-1699393 ATAAGTCACTTAACCTCTCTAGG + Intergenic
1142824740 17:2502062-2502084 ACAAATCACTTAACCTCTCTTGG - Intronic
1143262551 17:5610608-5610630 GGAAGTCACTTAACCTCTCTAGG - Intronic
1144131909 17:12254451-12254473 GCACATCACTTAACATTTCTCGG - Intergenic
1144470762 17:15539047-15539069 GTAAATAATTTAATTTCTCGGGG + Intronic
1144833866 17:18146498-18146520 GTAAGTTACTTAACCTCTCTGGG + Intronic
1145827763 17:27890055-27890077 GCAAATTACTTAACCTCTCAGGG - Intronic
1146394372 17:32451386-32451408 GTAAATAAGTTCAGGTCTCTAGG + Intronic
1146469658 17:33113786-33113808 GCAAGTCACTTAACCTCTCTGGG - Intronic
1146502814 17:33378927-33378949 GCAAGTGACTTAACCTCTCTGGG + Intronic
1146676845 17:34779604-34779626 ACAAATCACTTAACCTCTCTGGG - Intergenic
1146685765 17:34840700-34840722 GCAAGTTGCTTAACATCTCTGGG - Intergenic
1148546453 17:48522774-48522796 GTAAGTCACTTAACCTCTCTGGG - Intergenic
1148757527 17:49981392-49981414 GCAAGTCACTTCACATCTCTGGG + Intergenic
1148902898 17:50891902-50891924 GCAAATAACTTTGCCTCTCTGGG - Intergenic
1149039789 17:52173908-52173930 GTAAGTCACTTAAAATCTCCAGG + Intergenic
1149203349 17:54214284-54214306 GAAAATAACTTCTGATCTCTAGG + Intergenic
1149414068 17:56440151-56440173 GAAACTAAATTAACATCTCAAGG + Intronic
1149646090 17:58242666-58242688 GCAGGTTACTTAACATCTCTGGG - Intronic
1149668397 17:58382936-58382958 AAAAATAACTTAACAAATCTGGG - Intronic
1150017931 17:61578217-61578239 GTAAATTACTTAACCTCTTCGGG - Intergenic
1150041819 17:61870894-61870916 GCAAGTCACTTAACTTCTCTGGG + Intronic
1150320487 17:64209704-64209726 GGCAATAACTTAACTTCTGTGGG + Intronic
1150504665 17:65686157-65686179 GGAAAGAACCCAACATCTCTTGG + Intronic
1150980921 17:70140462-70140484 GCAATTTACTTAACCTCTCTGGG + Intergenic
1151004325 17:70416293-70416315 TTAAGCAACTTAACTTCTCTAGG + Intergenic
1151659882 17:75513501-75513523 GCAAGTCACTTAACCTCTCTGGG - Intronic
1151966679 17:77435145-77435167 GCAGGTTACTTAACATCTCTGGG - Intronic
1152383302 17:79953515-79953537 GCAAATTACTTAACCTCTCTGGG - Intronic
1152421286 17:80194489-80194511 GTCACTAACTCAACCTCTCTGGG + Intronic
1155383763 18:25254075-25254097 GCAAAGAACTTAATTTCTCTGGG - Intronic
1155515691 18:26622050-26622072 TTAAGTCATTTAACATCTCTGGG + Intronic
1155623674 18:27810230-27810252 GTAAGAAACTCAACATCTATAGG - Intergenic
1155922019 18:31612968-31612990 GTGAATGACCTAACATTTCTAGG + Intergenic
1156770761 18:40720655-40720677 GTAAATGAATTAACTTCTCCAGG + Intergenic
1156861079 18:41837118-41837140 GTAAAACATTTAACATCCCTGGG + Intergenic
1157113267 18:44840984-44841006 GTGATTAACTTAAACTCTCTAGG - Intronic
1157122625 18:44925873-44925895 GCAAGTAACCTAACCTCTCTGGG - Intronic
1157171318 18:45408873-45408895 GTATATTACTTTACCTCTCTGGG + Intronic
1157760688 18:50262521-50262543 GCAAATCACTTAATGTCTCTGGG - Intronic
1158255548 18:55544198-55544220 GTAAGTAATTTAATTTCTCTGGG + Intronic
1158363673 18:56706458-56706480 GCAGGTTACTTAACATCTCTAGG + Intronic
1159378019 18:67619323-67619345 GTATATAATTTAACATATCAAGG - Intergenic
1161184904 19:2911058-2911080 ATAAATAAATAAATATCTCTAGG - Intronic
1161644801 19:5446501-5446523 GCAAGTCACTTAACCTCTCTGGG + Intergenic
1161691400 19:5736755-5736777 GTAAATAAATAAACTTTTCTAGG + Intronic
1161746771 19:6064967-6064989 GCAAACCACTTAACATCTTTAGG - Intronic
1161787485 19:6336346-6336368 GTAAGTTCCTTAACTTCTCTGGG - Intergenic
1162300202 19:9840569-9840591 GCAAGTTACTTAACATCTCTGGG + Intronic
1162333403 19:10044865-10044887 ATAAGTCACTTAACCTCTCTGGG - Intergenic
1162343671 19:10107255-10107277 GCAAGTTACTTAACCTCTCTGGG + Intronic
1162426084 19:10596799-10596821 GTAAATTACTTCACCTCTCTGGG + Intergenic
1162735759 19:12746061-12746083 GCAAATCACTTCACCTCTCTGGG + Intronic
1163647687 19:18499320-18499342 GTAAGACACTTAACCTCTCTGGG + Intronic
1163793797 19:19323846-19323868 GCAAATCACTTTACCTCTCTGGG - Intronic
1164585270 19:29466006-29466028 GTAAAAAAGCTAACAACTCTTGG + Intergenic
1165307116 19:35009602-35009624 GTGAGTTACTTAACCTCTCTGGG + Intronic
1165465352 19:35971426-35971448 ATAAATTATTTAACCTCTCTGGG + Intergenic
1165734813 19:38169488-38169510 GCAAGTAACTGAACCTCTCTGGG + Intronic
1165744926 19:38224845-38224867 GCAAATGACTTAACCTTTCTGGG + Intronic
1165927109 19:39333745-39333767 GCAAATGCCTTAACACCTCTGGG - Intronic
1165950547 19:39471901-39471923 ATAAATAACTTAAAATAACTTGG - Intronic
1166522847 19:43492715-43492737 TTAAACAACTTAACCTCTCTTGG + Intronic
1166525174 19:43506161-43506183 GTAAGTTACTTCACTTCTCTAGG - Intergenic
1166802117 19:45464529-45464551 GTGAATAACTTAACCTCTCTGGG + Intronic
1166889807 19:45983885-45983907 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1166938914 19:46351218-46351240 GCAAATGACTTAACTTCTCTGGG + Intronic
1167039829 19:47017225-47017247 GCAAGTAACTTCACCTCTCTGGG - Intergenic
1167290156 19:48620052-48620074 GAAAATCACTTAACTTCTTTGGG + Intronic
1167506158 19:49872230-49872252 GCAAGTGACTTAACTTCTCTGGG - Intronic
1168523014 19:57067683-57067705 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1202698954 1_KI270712v1_random:148342-148364 GCAAATTACTTAACTTCTCTGGG + Intergenic
926344390 2:11931828-11931850 GCAAATAACTTAACCTCTTTCGG + Intergenic
926434428 2:12823993-12824015 GCAAATCTCTTAACTTCTCTGGG + Intergenic
926698381 2:15786127-15786149 GCAAGTTACTTAACATGTCTGGG - Intergenic
926809005 2:16739965-16739987 GCAAGTTACTTAACCTCTCTGGG - Intergenic
926856965 2:17267475-17267497 GCAAATTACTTAACTTCTCAAGG - Intergenic
927061792 2:19429906-19429928 ATAAATAAGTCAAAATCTCTGGG - Intergenic
927852588 2:26509689-26509711 GCAAATCTCTTAAGATCTCTGGG + Intronic
928051645 2:28003324-28003346 ATAAATAAATTGAAATCTCTGGG - Intronic
928344272 2:30476273-30476295 GCAAATTATTTAACCTCTCTGGG - Intronic
928345540 2:30490580-30490602 CTAAATTACTTTACTTCTCTGGG + Intronic
928428439 2:31198589-31198611 GGAAATAAATTAAAAGCTCTGGG + Intronic
928633903 2:33222764-33222786 GAAAGTCACTTAACCTCTCTGGG - Intronic
928892583 2:36221329-36221351 GTAATTAACTCCCCATCTCTGGG + Intergenic
929042481 2:37758947-37758969 GTAAATTACTTAACCTCCCTAGG + Intergenic
929284188 2:40116956-40116978 GAAGATTACTTAACTTCTCTGGG + Intronic
930426288 2:51216982-51217004 GCAAATCACTTAACTTCTTTGGG - Intergenic
930511613 2:52352269-52352291 TTAAATATCTTACGATCTCTTGG + Intergenic
930658980 2:54035106-54035128 CAAAATCACTTAACTTCTCTAGG + Intronic
930955660 2:57199356-57199378 TTAAATGACTTAACATCTAATGG + Intergenic
931487712 2:62709524-62709546 ATTAATAACTTAAAAGCTCTAGG - Intronic
934148920 2:89126283-89126305 GTAAGTAATTTAACATCTTTGGG - Intergenic
934169904 2:89531823-89531845 GAAAATTATTTAACTTCTCTGGG + Intergenic
934218376 2:90055763-90055785 GTAAGTAATTTAACATCTTTGGG + Intergenic
934280206 2:91606131-91606153 GAAAATTATTTAACTTCTCTGGG + Intergenic
935025063 2:99268941-99268963 GCAACTGACTTAACACCTCTGGG + Intronic
935195529 2:100812804-100812826 GCAAGTAACTCCACATCTCTAGG + Intergenic
935282683 2:101532786-101532808 TTAACTAACGTAACTTCTCTGGG + Intergenic
935384468 2:102486212-102486234 GTGAATCACTTACCCTCTCTGGG + Intronic
936012140 2:108931572-108931594 GCAAATCACTTAACCTCTCTGGG - Intronic
936033083 2:109087625-109087647 GCAAATTACTGAACCTCTCTGGG + Intergenic
936698694 2:114983850-114983872 GTAAATTGCTTAACCTCTCCAGG - Intronic
936703250 2:115039147-115039169 GTAGGGAACTTAACATTTCTTGG + Intronic
936842585 2:116790780-116790802 GTAAATCACTTTACCTCTTTGGG - Intergenic
937036683 2:118787952-118787974 GTAAGTTGCTTAACCTCTCTGGG - Intergenic
937104769 2:119300117-119300139 GCAAATAACTTTACCTCTCTGGG + Intergenic
937121167 2:119440729-119440751 TTAAATCACTTAAAATCACTGGG - Intronic
937759339 2:125581653-125581675 GTAAACTAATTAACCTCTCTAGG + Intergenic
938628491 2:133138324-133138346 GTAAACAACTTACTTTCTCTTGG - Intronic
939277711 2:140021860-140021882 GTAAATAACTGCATTTCTCTGGG - Intergenic
939400639 2:141688605-141688627 GTAAATCATATAACCTCTCTGGG - Intronic
939542795 2:143513911-143513933 ACAAATAACTCAATATCTCTGGG + Intronic
939587842 2:144026656-144026678 ATGATTCACTTAACATCTCTGGG + Intronic
939613258 2:144334492-144334514 GTAAACAACTTACCCTCTCTGGG - Intergenic
939961254 2:148567952-148567974 GCAAGTGACTTAACCTCTCTGGG - Intergenic
940825217 2:158403985-158404007 GTAAATTACTTAACCTCTCTTGG + Intronic
941030104 2:160501077-160501099 GAAAATAACTAAAAATCTGTTGG + Intergenic
941833845 2:169994241-169994263 GTAAATAACTCAGCTTTTCTTGG + Intronic
941965784 2:171299493-171299515 GTGAGTCACTTAACCTCTCTGGG - Intergenic
942191407 2:173474043-173474065 GCAAGTAACTTAACTTCTCTGGG + Intergenic
942205248 2:173613577-173613599 GCAAGTTACTTAACCTCTCTGGG + Intergenic
942394099 2:175527699-175527721 GAAAATTACTTAACTTCTATGGG + Intergenic
942516081 2:176754820-176754842 TTACTTTACTTAACATCTCTGGG + Intergenic
942660840 2:178263564-178263586 ACAAGTAACTTACCATCTCTGGG - Intronic
943569908 2:189561365-189561387 GTAAATACCTTAAGATCAATAGG + Exonic
943804659 2:192109473-192109495 GTTAAAAATTTAACATCTCTTGG - Intronic
943812863 2:192211480-192211502 GCAAGTAACTTGACCTCTCTGGG - Intergenic
944415611 2:199476712-199476734 CTTGATAACTTCACATCTCTGGG - Intergenic
944692130 2:202168004-202168026 GTAAGTTACTAAACTTCTCTGGG + Intronic
945183752 2:207118635-207118657 GCAAATTACTTGACTTCTCTGGG + Intronic
945215972 2:207434411-207434433 GCAAATTACCTAACTTCTCTGGG - Intergenic
945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG + Intergenic
945689537 2:213016264-213016286 GGAAATTACTTAACATCTCTGGG - Intronic
945808338 2:214517470-214517492 CCAAGTAAATTAACATCTCTAGG + Intronic
946259997 2:218480448-218480470 GAAAATAAAATACCATCTCTAGG + Intronic
946449642 2:219768895-219768917 GCAAGTTACTTAACCTCTCTTGG - Intergenic
946477982 2:220027479-220027501 GTAAGTCACTTAACCTCTCCAGG - Intergenic
946819161 2:223612720-223612742 GCAAATTACTTAACCTCCCTGGG + Intergenic
947075235 2:226335955-226335977 GAAAATTACTTAACCTCTCTTGG + Intergenic
947234464 2:227925494-227925516 GCAAATTACTTAACTTCTCAGGG - Intergenic
947927150 2:233931923-233931945 GTAAAATACTGAACTTCTCTGGG - Intronic
948158163 2:235801243-235801265 GCAAATTACTTGACCTCTCTGGG + Intronic
948736964 2:240015142-240015164 GTAAGTAGCTTAATTTCTCTGGG - Intronic
1168971804 20:1936457-1936479 GCAATTCACTTAACCTCTCTGGG - Intronic
1168987233 20:2059974-2059996 GTAAGTCACTTTACCTCTCTGGG - Intergenic
1169026601 20:2376787-2376809 GCAAATAAGTTAACCTTTCTAGG - Intergenic
1169431989 20:5544680-5544702 GTATATCAGTTAACCTCTCTGGG + Exonic
1169467209 20:5851861-5851883 TTAAATTAATTAACATCTTTAGG + Intronic
1169843149 20:9961657-9961679 GTAAATTACTTAACCCCTTTGGG - Intergenic
1170264855 20:14454681-14454703 ACAAATCACTTAACTTCTCTGGG - Intronic
1170594606 20:17795548-17795570 GCAAATCGCTTAACCTCTCTGGG - Intergenic
1171095896 20:22332069-22332091 GTAAGTGACTTAACCCCTCTGGG - Intergenic
1171228912 20:23466582-23466604 CTAAACAATTTAACTTCTCTGGG - Intergenic
1171967107 20:31538974-31538996 GCAAATTTCTTAACCTCTCTGGG - Intronic
1172229785 20:33328922-33328944 ATAAATCACTTAATCTCTCTGGG - Intergenic
1172968266 20:38854654-38854676 GCAAGTAACTTAACCTCTTTTGG + Intronic
1172980206 20:38935850-38935872 GTAACTATCTTGACATCTTTGGG - Intronic
1173029743 20:39343896-39343918 GTAAATTACTTAGCAATTCTGGG + Intergenic
1173335380 20:42108352-42108374 GCAAATGACTTAACCTCTCTGGG + Intronic
1173595454 20:44256159-44256181 GTAGATTACTTGCCATCTCTGGG + Intronic
1173653829 20:44685209-44685231 GTAAGCAACTTCACCTCTCTGGG - Intergenic
1174000270 20:47369444-47369466 GTAAGTAACTTAACCTCTCTGGG + Intergenic
1174205179 20:48833048-48833070 GTAAGTGACTTAACCTCTCTGGG + Intergenic
1174284950 20:49465869-49465891 GTGAATCACTTAACTTCTCTGGG - Intronic
1174303584 20:49599903-49599925 GCAAATTACTTCACCTCTCTGGG - Intergenic
1174586440 20:51612184-51612206 GCAAATAACTTTACTACTCTAGG - Intronic
1175027556 20:55918707-55918729 GTGAATTACTTAACCTCTCTAGG - Intergenic
1175074557 20:56361574-56361596 GTAAATTACTCAACCTCTCTGGG + Intronic
1175159403 20:56996705-56996727 GCAAGTCACTTAACCTCTCTGGG - Intergenic
1175543156 20:59760938-59760960 GAAAGTGACTTAACCTCTCTGGG - Intronic
1176970098 21:15255256-15255278 GCAAGTCACTTAACTTCTCTAGG - Intergenic
1177228259 21:18285272-18285294 GAAAATAACTTCACCACTCTAGG + Intronic
1177944496 21:27450534-27450556 GTAGAAAAGCTAACATCTCTTGG - Intergenic
1178140284 21:29675127-29675149 GTAAGTTACTTAACTACTCTGGG - Intronic
1178704626 21:34863127-34863149 GAAAATTACTTAACCTTTCTGGG - Intronic
1178714269 21:34949074-34949096 GGAAATAAATGAACATCTCCAGG - Intronic
1181772683 22:25137859-25137881 CTAAGTCACTTAACCTCTCTGGG - Intronic
1181904330 22:26181617-26181639 GTAAATTACTTAACCTCTCTAGG + Intronic
1181953701 22:26572979-26573001 GTAAATCACTTAACCTCTCTGGG + Intronic
1182170023 22:28219154-28219176 GCACATTACTTAACGTCTCTTGG + Intronic
1182341671 22:29627271-29627293 GTAAGTCACTTAACCTCTTTGGG - Intronic
1182425117 22:30267584-30267606 GCAAGTCACTTAACCTCTCTGGG + Intergenic
1182571443 22:31241894-31241916 ATAAATTATTTAACATCTCTGGG - Intronic
1182587102 22:31350308-31350330 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1182832000 22:33311895-33311917 GCAAGTCACTTAACATCTTTGGG - Intronic
1183095232 22:35547983-35548005 GTGAGTTACTTAACCTCTCTGGG - Intronic
1183237947 22:36634103-36634125 GTAAGTTACTTAGCATCTCTGGG + Intronic
1184832385 22:46996951-46996973 GCAAGTAACATAACCTCTCTGGG - Intronic
1203294671 22_KI270736v1_random:30441-30463 GTAAATTACTTAACCTCCCTAGG + Intergenic
949609369 3:5688419-5688441 GCAAATTACTTAACTTCTCTGGG - Intergenic
949823814 3:8143392-8143414 GCAAGTTTCTTAACATCTCTAGG - Intergenic
950435659 3:12978185-12978207 GCAAATTACTTACCTTCTCTAGG - Intronic
950852853 3:16079456-16079478 GTAAGTTAGTTAACTTCTCTGGG - Intergenic
950915200 3:16637561-16637583 GTAAGTTACTTAGCCTCTCTGGG + Intronic
951027141 3:17842198-17842220 GCAAATTACTTAACCTCCCTGGG + Intronic
951152733 3:19311334-19311356 GCAAATTACTTAACCTCTTTTGG - Intronic
951249275 3:20375346-20375368 ATAAATTACTCAGCATCTCTAGG - Intergenic
951431211 3:22609169-22609191 GCAAATAACTTTTCCTCTCTAGG + Intergenic
951549175 3:23859641-23859663 GTTAATTACTTAAAGTCTCTGGG + Intronic
951703573 3:25521707-25521729 GCAAGTCACTTAACCTCTCTGGG + Intronic
951812670 3:26717903-26717925 GCAAGTAACTTAGCATCTCTGGG - Intergenic
952601369 3:35087666-35087688 GCAATTCATTTAACATCTCTGGG + Intergenic
953529727 3:43729488-43729510 GCAAGTCACTTAACCTCTCTGGG - Intronic
954545123 3:51427621-51427643 GTAAATAAAATAAAATCTCTTGG - Intronic
954945516 3:54420729-54420751 GTAATTTATTTAACTTCTCTGGG - Intronic
955192314 3:56772933-56772955 GCAGGTGACTTAACATCTCTAGG - Intronic
955584709 3:60463754-60463776 GCAATTTACTTAACTTCTCTGGG + Intronic
955683397 3:61526037-61526059 GTAAATTACTTCAACTCTCTAGG - Intergenic
955864422 3:63367732-63367754 GAAAGTCACTTACCATCTCTGGG - Intronic
956045983 3:65196360-65196382 TTAAATACCTTAACATCGCCCGG + Intergenic
956599999 3:71010359-71010381 GTAAATCATTTAACCTCTCTGGG + Intronic
956720411 3:72112636-72112658 GCAACTTACTTAACCTCTCTGGG + Intergenic
957038380 3:75316045-75316067 GCAAATCACTTAACCTCTCTGGG - Intergenic
957138279 3:76318063-76318085 GTAAATAACATGAAATCTCAGGG - Intronic
957863772 3:85995586-85995608 GTAAATATCTTATTTTCTCTGGG - Intronic
958938544 3:100284874-100284896 GTAATTAAATGAAAATCTCTTGG + Intronic
959000411 3:100957715-100957737 GCAAGTAGCTTAACATCTCTGGG - Intronic
959546634 3:107604110-107604132 GCAATTAAATTAAAATCTCTCGG - Intronic
960252651 3:115473352-115473374 GCAAGTTACTTAACCTCTCTAGG - Intergenic
960464817 3:117984615-117984637 GAAAGTCACTTAACATCTCCTGG - Intergenic
960587632 3:119334839-119334861 GCAAATTACTTAACTTCTCTGGG - Intronic
960855016 3:122093833-122093855 GTAAATTACTTCATCTCTCTGGG - Intronic
961086410 3:124071358-124071380 GCAAATCACTTAACCTCTCTGGG - Intergenic
961867297 3:129963006-129963028 GTACATCACTTAACATCTCTAGG - Intergenic
962011093 3:131391725-131391747 TTACATAACTTACCGTCTCTTGG - Intergenic
962372909 3:134835551-134835573 GCAAATCACTTCACCTCTCTGGG - Intronic
962864198 3:139433918-139433940 GCAAATTACTTAACCTCTATGGG + Intergenic
963721451 3:148866606-148866628 GCAACTTACTCAACATCTCTGGG + Intronic
963895319 3:150679493-150679515 GTAAATGACTTAATCTTTCTGGG - Intronic
963921797 3:150912771-150912793 GTAAGTCACTTATCCTCTCTGGG + Intronic
964408442 3:156374195-156374217 GAAACTCACTTAACCTCTCTAGG + Intronic
964442098 3:156722593-156722615 CCAAATAACTTAACCCCTCTAGG + Intergenic
964521805 3:157577579-157577601 AAAAATAATTTAACTTCTCTAGG + Intronic
964721124 3:159768057-159768079 GCAAATCACTTAACCTCTCTGGG - Intronic
965101396 3:164303751-164303773 TTAAAGAATTTAACATGTCTGGG + Intergenic
965282315 3:166769827-166769849 GTAAAGACCTTAAAATCTCATGG - Intergenic
965737991 3:171842239-171842261 GCAAGTTACTTAACTTCTCTAGG - Intergenic
966240043 3:177745759-177745781 GTAAATAGCTTAGCCTCTCTGGG - Intergenic
966249108 3:177842273-177842295 GTAAATCACTTCACAACTCTGGG + Intergenic
966330369 3:178805408-178805430 GAAAGTCACTTAACATCTTTAGG - Intronic
966373809 3:179275412-179275434 TTAAATAACTTTAAGTCTCTTGG - Intergenic
966940514 3:184743396-184743418 GCAAGTCACTTAACCTCTCTGGG - Intergenic
967000177 3:185326611-185326633 GTAATTTGCTTAACCTCTCTGGG - Intronic
967226132 3:187292986-187293008 GAAAGTTACTTAACCTCTCTGGG - Intergenic
967407530 3:189134195-189134217 GTAAATCACCTGCCATCTCTGGG + Intronic
967437061 3:189459541-189459563 GCAAATCACTTAGCACCTCTGGG + Intergenic
967462985 3:189768105-189768127 ATGAATAACTAACCATCTCTAGG + Intronic
967674486 3:192279773-192279795 GTAAATAACTTACATTTTCTGGG + Intronic
967947451 3:194815224-194815246 GCAAATCACTTAACCTCTCTCGG - Intergenic
969030560 4:4209724-4209746 GCAAATTACTTAACTTCTCTGGG - Intronic
969257263 4:6010972-6010994 GCAAGTGACTTAACCTCTCTGGG - Intergenic
969350200 4:6593891-6593913 GAAAATTCCTTAACCTCTCTGGG - Intronic
970258924 4:14202910-14202932 GTAAATCACCTAACTTCTCTTGG + Intergenic
970270105 4:14337363-14337385 GTAAATATCCTAACTTCTTTGGG + Intergenic
970387660 4:15572250-15572272 GCAAGTTACTTAACCTCTCTAGG - Intronic
971502404 4:27331410-27331432 AGAAATCACTTAACATTTCTGGG + Intergenic
971575208 4:28264094-28264116 GAAAATCATTTAACCTCTCTGGG - Intergenic
972014137 4:34223046-34223068 TTAAATAATTGAACCTCTCTTGG + Intergenic
972675393 4:41255675-41255697 GTAAGCAAATTAACTTCTCTAGG + Intergenic
972869819 4:43283810-43283832 GTAACTAAATTAAAATCTGTAGG - Intergenic
974343889 4:60652998-60653020 GAAAATACCTTCACATTTCTTGG - Intergenic
974366829 4:60961176-60961198 TTAATTAACTCAAAATCTCTTGG + Intergenic
974837441 4:67267994-67268016 ACATATAATTTAACATCTCTAGG - Intergenic
974887011 4:67832053-67832075 GTAAATATATTAACATTTCAAGG + Intronic
975082038 4:70293106-70293128 GTAAAAAACTTAACTCCTCAAGG - Intergenic
975263009 4:72327579-72327601 GCAAGTTACTTAACTTCTCTGGG - Intronic
975536002 4:75451133-75451155 GCAAAAAACTTAACACCTTTTGG + Intergenic
975656363 4:76645001-76645023 GTAAATTACTTAATCTCTCTAGG - Intronic
975880247 4:78897232-78897254 GAAAATAACATAACATCTTGGGG + Intronic
976266740 4:83192343-83192365 GCAAGTTACTTAACATCTCTGGG - Intergenic
976276313 4:83282758-83282780 ATAAATTACTTCACCTCTCTGGG - Intronic
976980563 4:91221007-91221029 TTAAATAAACTAAAATCTCTAGG + Intronic
977085617 4:92594038-92594060 GAAAATTATTTAACCTCTCTGGG - Intronic
977152373 4:93528957-93528979 GTAAATCACTTAACCTTTTTAGG - Intronic
977634697 4:99283680-99283702 GCAAATATCTTTATATCTCTGGG + Intronic
978187660 4:105876034-105876056 GTGAGTTACTTAACCTCTCTTGG + Intronic
978587385 4:110288463-110288485 GTTATTAATTTCACATCTCTGGG - Intergenic
978751697 4:112255906-112255928 GCAAATTACTTAACCTCCCTGGG + Intronic
978818858 4:112940925-112940947 ATTAAAAACTTAACATCTATGGG + Intronic
978869082 4:113553204-113553226 GCAAGTTACTTAACTTCTCTGGG - Intronic
979283174 4:118890402-118890424 GCAAGTTACTTAACATCTCTGGG - Intronic
979722464 4:123917454-123917476 ACAAGTTACTTAACATCTCTGGG - Intergenic
980204427 4:129699113-129699135 GAAAAGTACTTAACCTCTCTGGG + Intergenic
980921107 4:139086809-139086831 ATAAATAATTTAACATCCTTGGG - Intronic
980930713 4:139179838-139179860 GTAAATAACTTATCACTTATGGG + Intergenic
981316552 4:143345758-143345780 TTAAATAGCTAAATATCTCTAGG - Intronic
981354216 4:143768539-143768561 GTAAATAACTTAACATCTTTGGG + Intergenic
981576464 4:146211315-146211337 GTAAATCACTTAACTTCTCTGGG - Intergenic
981603306 4:146516374-146516396 GTAAATAACATTACATATATAGG + Intronic
982447898 4:155515531-155515553 GTAAAATATTTAAAATCTCTGGG - Intergenic
982493236 4:156056347-156056369 ACACATCACTTAACATCTCTGGG - Intergenic
982836813 4:160129387-160129409 GGAAATAAATTATCAACTCTTGG + Intergenic
982873218 4:160610640-160610662 ATAAATAAATTAAATTCTCTAGG + Intergenic
983733835 4:171032348-171032370 AGAAATTACTTAACCTCTCTAGG - Intergenic
984028088 4:174569511-174569533 GAAAAGAGCTTAACATCTGTGGG - Intergenic
984430634 4:179643737-179643759 CTGAATAACTTAACAATTCTTGG + Intergenic
984596067 4:181669320-181669342 GTAAGTTACATAACCTCTCTGGG - Intergenic
984817833 4:183854661-183854683 GTAAATTATTTGACATCTCATGG + Intronic
986476357 5:8137707-8137729 GTAAATAACATATCATATTTTGG + Intergenic
989051979 5:37330540-37330562 GTAAATTACTTGACTTCTCTGGG - Intronic
989359609 5:40585770-40585792 GGAAATTACCTAACCTCTCTGGG + Intergenic
990593990 5:57294813-57294835 GTAAATAACTTAATCTTTTTAGG + Intergenic
990684103 5:58280225-58280247 GTAAATAAACTAACATTTATGGG + Intergenic
990801239 5:59606498-59606520 GCAAGTAACTTAACCTCTCCAGG - Intronic
991095452 5:62735086-62735108 GAAAGTAACTTAACCTCTTTGGG + Intergenic
991925451 5:71701007-71701029 GCAAATTACTTAGCCTCTCTGGG + Intergenic
992396813 5:76376188-76376210 GCAAATTATTTAACTTCTCTGGG + Intergenic
992861917 5:80919865-80919887 GCAAGTTACTTAACTTCTCTGGG + Intergenic
992920963 5:81519784-81519806 GAAAATAAATCATCATCTCTGGG - Intronic
993038557 5:82785555-82785577 CTAAATAATTTAACCTCTCCAGG + Intergenic
993109239 5:83635252-83635274 GTAAATCATTTAACATTTCTTGG - Intergenic
993326269 5:86541798-86541820 ATAAAAAAATTAACATATCTTGG - Intergenic
993419313 5:87681063-87681085 GATAATGACTTAACAACTCTGGG + Intergenic
993428296 5:87798389-87798411 GTAAATAACTAAACAACACCAGG - Intergenic
994005744 5:94835480-94835502 GCAAGTGACTTAACGTCTCTGGG + Intronic
994869241 5:105323446-105323468 GTAAGTAAATTAATATTTCTTGG + Intergenic
994998758 5:107100559-107100581 GCAAATCACTTAACCTCTCTTGG + Intergenic
995502009 5:112817294-112817316 GTAAATAATATAATAGCTCTTGG + Intronic
995575080 5:113521241-113521263 GAAAATTACTTAACATCTCTAGG - Intronic
995836459 5:116404670-116404692 GTAAATGCCTTAACCTCTCTGGG + Intronic
995841980 5:116451098-116451120 GCAAGTGACTTAACATCTCTGGG + Intronic
995858390 5:116617021-116617043 GCAAGTTACTTAACCTCTCTGGG + Intergenic
996461770 5:123753025-123753047 GCAAGCAACTTAACATTTCTGGG + Intergenic
996590046 5:125136725-125136747 GTAGATTATTTAACTTCTCTTGG + Intergenic
996854800 5:127993532-127993554 GTAAACACATTCACATCTCTTGG - Intergenic
996909837 5:128642976-128642998 GTAAATTACTTTACCTTTCTGGG + Intronic
997041463 5:130260438-130260460 TTAAAACACTTAACATTTCTGGG + Intergenic
997151901 5:131505844-131505866 GTAAATTATTTAACCTCTCTGGG + Intronic
997480436 5:134180412-134180434 GTAACTTACTTCACCTCTCTGGG + Intronic
998001303 5:138628354-138628376 GCAAGTTACTTAACCTCTCTGGG - Intronic
998188075 5:139998205-139998227 GTAAACCACTTAACTTCTTTGGG + Intronic
998198459 5:140097358-140097380 TTAAATTACTTAACCTCTATAGG - Intergenic
998281507 5:140812545-140812567 ATAAAAAACTTAACAACTCAAGG - Intronic
998729226 5:145054731-145054753 ATAAATAACATATCATCTCAGGG + Intergenic
998955179 5:147431382-147431404 ATAAATGACTTCACCTCTCTGGG + Intronic
999056677 5:148585621-148585643 GCAAGTCATTTAACATCTCTGGG - Intronic
999191290 5:149749337-149749359 GTAAGTCACTTCACATCCCTGGG - Intronic
999192536 5:149759381-149759403 GAAAATAACTGCACTTCTCTTGG + Intronic
999274168 5:150317793-150317815 GCAAGTCACTTAACCTCTCTGGG + Intronic
999559000 5:152778794-152778816 GTTAATAAATTAATATATCTAGG + Intergenic
999579281 5:153017532-153017554 ATAAACAACTTTACATCTCATGG + Intergenic
999712427 5:154330454-154330476 GTAAGTCACTTAACTTCTCTGGG - Intronic
1000288675 5:159849616-159849638 GCAAATAATTTAACCTCTCTGGG - Intergenic
1000468850 5:161613213-161613235 GAAAATCACTTCACCTCTCTGGG + Intronic
1000524752 5:162343512-162343534 TTAAATACCTTAAGATATCTAGG + Intergenic
1000540061 5:162528459-162528481 GTAAGTCATTTAACAGCTCTGGG + Intergenic
1001082094 5:168674974-168674996 GTAAATCACTTAACCTCTCTGGG - Intronic
1001220556 5:169896434-169896456 GTAAATTACTTAACCTCTCTGGG + Intronic
1001363600 5:171113620-171113642 GGATATCACTTAACTTCTCTAGG - Intronic
1003366243 6:5477612-5477634 GCAAATTACTTAATGTCTCTGGG + Intronic
1003408208 6:5840415-5840437 ATAAGTCACTTAACTTCTCTGGG + Intergenic
1003798555 6:9634307-9634329 GTGAATATCTTAACATTTCTTGG - Intronic
1003861392 6:10325258-10325280 GTAATTTACTCAACCTCTCTGGG + Intergenic
1003974185 6:11327161-11327183 GCAAGTCACTTAACATCTCTGGG + Intronic
1004243050 6:13945200-13945222 GTAAATCACTTAAACTTTCTGGG - Intronic
1004490033 6:16105831-16105853 GCAAATGTCTTAAAATCTCTGGG + Intergenic
1004655247 6:17653560-17653582 GTAAATAAATTTATTTCTCTGGG - Intronic
1004782928 6:18932250-18932272 CAAAATACCTTAACATCTTTAGG - Intergenic
1004979518 6:21007780-21007802 GCAAATTACTTAACATCTTTGGG - Intronic
1005160993 6:22863493-22863515 GCAAATTACTTAATCTCTCTGGG + Intergenic
1006134082 6:31885138-31885160 GTAAGTCACTTAACGTCTCTGGG + Intronic
1006442585 6:34061528-34061550 GTGAATTTCTTAACCTCTCTGGG - Intronic
1006764361 6:36491660-36491682 GTTAACAGGTTAACATCTCTGGG + Intergenic
1006814659 6:36841789-36841811 GTAAGTTACTTAGCCTCTCTGGG - Intergenic
1006955311 6:37864882-37864904 GTAAATAGCTTAATATGGCTGGG + Intronic
1007252332 6:40504271-40504293 GAAAGTTACTTAACTTCTCTGGG + Intronic
1007278376 6:40692170-40692192 GCAAGTCACTTAACCTCTCTGGG - Intergenic
1007283393 6:40729365-40729387 GTCACTTACTTAACATCTCTGGG + Intergenic
1007484574 6:42172021-42172043 GCAAGTAACTTAACCTCTCTGGG - Intronic
1007507140 6:42344420-42344442 GTAAATAACTCATCTTCTCTGGG - Intronic
1007737165 6:43988960-43988982 GCAAGTCACTTAACCTCTCTGGG + Intergenic
1007970922 6:46051331-46051353 GCAAATTACTTAACCTCTCTGGG + Intronic
1008368939 6:50712164-50712186 GAAAATAACTAATCATCTCTGGG - Intergenic
1008373933 6:50769780-50769802 GCAAATTATTTAACTTCTCTGGG + Intronic
1008395030 6:50996149-50996171 GCAAATTAATTAACCTCTCTGGG + Intergenic
1008583908 6:52931614-52931636 GAAAGTTACTTAACATCTTTGGG + Intergenic
1008892313 6:56508927-56508949 CCAAATAACATAATATCTCTGGG + Intronic
1009307545 6:62109156-62109178 GTAAACAACTTTGCATTTCTAGG - Intronic
1009689387 6:67008843-67008865 GCAAATTATTTAACATCTCTGGG - Intergenic
1009786403 6:68345466-68345488 GTAAAAAACTTACCATCTCGTGG - Intergenic
1010498422 6:76565199-76565221 GCAAATTACCTAACATCTCTGGG - Intergenic
1010528419 6:76933814-76933836 AAATATATCTTAACATCTCTAGG + Intergenic
1010922239 6:81697331-81697353 ATAATGAACTTAACTTCTCTTGG + Intronic
1011011692 6:82710630-82710652 GACAATTACTTAACCTCTCTGGG + Intergenic
1011174585 6:84545952-84545974 GCAAATTACTTTACCTCTCTTGG + Intergenic
1011885278 6:92086260-92086282 CTAAATGACTTAACAGCTCAGGG + Intergenic
1012474042 6:99602341-99602363 CTAAATAACATATCCTCTCTTGG - Intergenic
1012574479 6:100775411-100775433 GTAAGTTATTTAACCTCTCTAGG - Intronic
1013284174 6:108666273-108666295 GCAAACTACTTAACCTCTCTGGG - Intronic
1014697650 6:124643666-124643688 GTAACTAACTTGATAACTCTAGG + Intronic
1014946613 6:127506052-127506074 GCAAATAACTTAAAATTTATAGG - Intronic
1015005451 6:128275340-128275362 GTAAATAGATTAACATATCAGGG - Intronic
1015020234 6:128464349-128464371 GTAAATTACTTAAGGTCCCTAGG + Intronic
1015134720 6:129854615-129854637 GAAAATCACTTAATTTCTCTGGG - Intronic
1015362857 6:132360285-132360307 GCAAATTACTTAACCTTTCTGGG + Intronic
1015418047 6:132972439-132972461 GAAAATTACTTAAGCTCTCTGGG - Intergenic
1015485617 6:133766718-133766740 GTAAATACCTGAACAACTCTAGG - Intergenic
1015638357 6:135303528-135303550 GTAAACCACTTAGCCTCTCTTGG + Intronic
1015820524 6:137255876-137255898 GTTAATCACTTAACTTCTCTGGG - Intergenic
1015929267 6:138340685-138340707 GCAAATTTCTTAACCTCTCTGGG - Exonic
1016020477 6:139231767-139231789 AGAAATTGCTTAACATCTCTGGG - Intergenic
1016093739 6:140010876-140010898 GTAAATAAGTTAACATCTTTGGG - Intergenic
1016214299 6:141578148-141578170 GCAAATTACTTAACATCTTAAGG - Intergenic
1016700858 6:147052604-147052626 GCAAATTTCTTAACTTCTCTAGG + Intergenic
1016738345 6:147505034-147505056 GTAAGGAACTTGACCTCTCTGGG + Intergenic
1017131751 6:151113824-151113846 GCAAAATACTTAACCTCTCTGGG + Intergenic
1017600294 6:156073085-156073107 GTAAATCACTTTTCTTCTCTGGG + Intergenic
1018256405 6:161924056-161924078 GGAAGTTACTTAACCTCTCTGGG + Intronic
1020031318 7:4934810-4934832 GAAAATTGCTTAACGTCTCTGGG + Intronic
1020665332 7:11033975-11033997 AAAAATTGCTTAACATCTCTGGG - Intronic
1020816488 7:12912062-12912084 GCAAGTAACCTAACCTCTCTGGG - Intergenic
1021122334 7:16810469-16810491 GGAAATCACTTAATAACTCTAGG - Intronic
1021603439 7:22387384-22387406 GTAATTAACTTGAGATCTATGGG + Intergenic
1021634555 7:22678968-22678990 GTAACCAACTTAACACATCTGGG - Intergenic
1021731867 7:23603578-23603600 GCAAGACACTTAACATCTCTGGG + Intronic
1021862855 7:24923989-24924011 ATAAATAAGTTAAAATATCTGGG + Intronic
1022348941 7:29548169-29548191 GAAAATTACTTAATATCTTTAGG - Intergenic
1022396339 7:29990283-29990305 GCAAGTTACTTAACCTCTCTAGG - Exonic
1022779484 7:33564428-33564450 GTAAGTAACTTAACCTTTCTGGG + Intronic
1023335171 7:39161552-39161574 GCAAATCACTTGACCTCTCTGGG - Intronic
1024050878 7:45622554-45622576 GTAAACATCTGTACATCTCTAGG + Intronic
1024167770 7:46751652-46751674 GTAACTTACTTGACATTTCTGGG - Intronic
1025195480 7:56929068-56929090 GTAAATGCATTAATATCTCTGGG + Intergenic
1025676472 7:63647871-63647893 GTAAATGCATTAATATCTCTGGG - Intergenic
1025888844 7:65625878-65625900 GTAATTCACTTTACTTCTCTGGG - Intergenic
1025984686 7:66439008-66439030 GTAAGTAATTTAACATCTCTTGG + Intergenic
1026030031 7:66783947-66783969 GTAAGTAATTTAACATCTCTTGG - Intronic
1026394010 7:69932977-69932999 GTAAATAATTTTACTTCACTGGG - Intronic
1026673196 7:72407211-72407233 GCAAGTGACTTAACCTCTCTGGG + Intronic
1026680976 7:72466410-72466432 GTAAATACCTTATGATCTCTTGG - Intergenic
1027207891 7:76117596-76117618 GTAAGTAATTTAACATCTCTTGG + Intergenic
1027912912 7:84275922-84275944 GTAAATAATTTTAAATTTCTAGG - Intronic
1028526067 7:91788309-91788331 GTAAGCCACTTAACTTCTCTGGG + Intronic
1029332929 7:99874900-99874922 GTAAGTTACTTAACCTCTCAAGG - Intergenic
1029371974 7:100156080-100156102 ATAAGTTACTTAACCTCTCTGGG - Intronic
1029608991 7:101616635-101616657 GCAAGTCACTTAACTTCTCTGGG - Intronic
1029991299 7:104965050-104965072 GCAAGTTACTTAACCTCTCTAGG + Intergenic
1030009991 7:105156284-105156306 GCAAGTTACTTAACCTCTCTGGG + Intronic
1030265410 7:107615918-107615940 ATAAATTATATAACATCTCTGGG - Intronic
1030512987 7:110507741-110507763 GTAAACAACTTAACAGCACCTGG - Intergenic
1030659272 7:112203127-112203149 GTAAATCACTTAGCCTTTCTGGG - Intronic
1030755287 7:113280362-113280384 GTTAGTCACTTAACTTCTCTGGG + Intergenic
1030835078 7:114274456-114274478 CTAAAGAATTTAACATTTCTTGG + Intronic
1030852921 7:114513124-114513146 TTAAATTACTCAACCTCTCTAGG + Intronic
1031033675 7:116763828-116763850 GTCAATCACTTAACCTTTCTGGG - Intronic
1031150092 7:118044232-118044254 ACAAATAAATTAAAATCTCTTGG - Intergenic
1031692465 7:124806255-124806277 GTAAATGACTTCACATCCTTGGG - Intergenic
1031867426 7:127053211-127053233 GGAAATCATTCAACATCTCTTGG + Intronic
1032081562 7:128861099-128861121 CTAAATATCTAAATATCTCTCGG + Intergenic
1032500244 7:132394601-132394623 GTAAATTCCTTCACCTCTCTGGG + Intronic
1032598558 7:133268175-133268197 GTAAGTGACTTAACTTTTCTGGG - Intronic
1032750423 7:134834535-134834557 GTAAACCATTTAACCTCTCTAGG + Intronic
1033010625 7:137618743-137618765 GTAACTCATTTAACATATCTTGG + Intronic
1033416438 7:141165798-141165820 GAAAATTACTTAACTTCTCTGGG + Intronic
1033451794 7:141468529-141468551 GCAAATGACTTAAGCTCTCTGGG + Intronic
1034752804 7:153586735-153586757 GTAAATTACTTAACCTCTCTGGG + Intergenic
1036568883 8:9962221-9962243 GTAAGTCACTTTACCTCTCTGGG + Intergenic
1036571063 8:9980180-9980202 GTAAATCACTTAATCTCTCCGGG - Intergenic
1037439917 8:18904727-18904749 GTAAATACCTTAACCTTTCTGGG + Intronic
1037523372 8:19701742-19701764 GTAAATTACTTAAACTTTCTGGG - Intronic
1037645820 8:20792009-20792031 GCAAATCACTTTACCTCTCTGGG + Intergenic
1037707185 8:21325209-21325231 GCAAATTACTTAACCTCTCCGGG + Intergenic
1037885230 8:22592510-22592532 GCAAATCCCTTAACCTCTCTGGG + Intronic
1038260127 8:25985530-25985552 GTAAGTCACTTAACCTCTCTGGG + Intronic
1038547791 8:28439241-28439263 ATAAGTTACTTAACCTCTCTAGG - Intronic
1038664650 8:29527700-29527722 GTAAGTCACTTAACCTCTCCGGG - Intergenic
1038889137 8:31699068-31699090 TTAAATAATTTAATATCACTGGG + Intronic
1038893744 8:31757084-31757106 GTAAATAAAGCCACATCTCTGGG + Intronic
1038975812 8:32694829-32694851 GCAAATAACTTACTCTCTCTGGG - Intronic
1039329773 8:36524350-36524372 GTGAATCATTTACCATCTCTAGG - Intergenic
1040430915 8:47341355-47341377 GTAAGTAACTTAAAACCTATGGG + Intronic
1042636126 8:70877446-70877468 GTAAATCACTTAAATTATCTAGG - Intergenic
1043109374 8:76159484-76159506 GTTAATGTCTTAGCATCTCTAGG - Intergenic
1043215656 8:77584024-77584046 GGAAAAAACTCAAGATCTCTTGG - Intergenic
1043480068 8:80643837-80643859 ATAAATCTCTTAACCTCTCTAGG - Intronic
1043540710 8:81259082-81259104 TTGAATCACTTAACCTCTCTGGG + Intergenic
1043618823 8:82162279-82162301 GTAGAAAAGTTAACATCTATTGG + Intergenic
1044463052 8:92469780-92469802 GCAACTCACTTAACTTCTCTGGG + Intergenic
1044620912 8:94190182-94190204 GCAAATAATTTAACCTCTTTGGG - Intronic
1044747068 8:95380969-95380991 GTAAATCACTTTGCTTCTCTGGG + Intergenic
1044903994 8:96979989-96980011 TTAAATAATTCAAAATCTCTAGG + Intronic
1045177057 8:99736917-99736939 GAAAATTATTTAACCTCTCTGGG - Intronic
1045209432 8:100081008-100081030 GTAAATCACTGAACATTTTTGGG + Intronic
1045798322 8:106072382-106072404 GTAAATCTCTTAAAATTTCTAGG + Intergenic
1045854607 8:106749535-106749557 TTAAGTCACTTAACCTCTCTGGG - Intronic
1046840203 8:118847701-118847723 GTAACTTACCTAACATCTTTAGG + Intergenic
1047087521 8:121535221-121535243 GGAATTCATTTAACATCTCTGGG - Intergenic
1047281929 8:123453297-123453319 GAAAGTCACTTAACCTCTCTGGG + Intronic
1047295599 8:123568155-123568177 GCAACTAACTTACCCTCTCTGGG + Intergenic
1047340217 8:123973857-123973879 GCAAATGACTTAACTTCTCTGGG + Intronic
1047379786 8:124349059-124349081 GTAAGTCACTTAACATCTGTGGG - Intronic
1047544399 8:125801666-125801688 GAAAATTACTTTACTTCTCTGGG + Intergenic
1047929380 8:129711709-129711731 GCAAGTTACTTGACATCTCTAGG + Intergenic
1048200924 8:132373264-132373286 GTAAGTCACTTAACCTCTCTGGG + Intronic
1050213125 9:3287470-3287492 GCAAATCATTTAACCTCTCTGGG + Intronic
1050221859 9:3400155-3400177 GTAAGTGATGTAACATCTCTGGG - Intronic
1050250678 9:3741075-3741097 GTAATTCACTTTACATGTCTAGG + Intergenic
1050703523 9:8368237-8368259 GCAAATCACTTAACTTCTCAGGG + Intronic
1050772071 9:9214882-9214904 TTACGTTACTTAACATCTCTGGG - Intronic
1050999728 9:12267056-12267078 ATAAAAAGCTTAACAGCTCTAGG + Intergenic
1051308948 9:15748101-15748123 GCAAGTGACTTAACCTCTCTGGG + Intronic
1051696577 9:19774323-19774345 ATACATTACTTAACCTCTCTGGG - Intronic
1052460372 9:28755354-28755376 GCAAACTACTTAACCTCTCTGGG + Intergenic
1052501637 9:29299185-29299207 GCAAGTCACTTAATATCTCTGGG - Intergenic
1054841462 9:69745714-69745736 GCAAATCACTTAATCTCTCTAGG + Intronic
1054951555 9:70857705-70857727 GAAAATAATTTAACTTCTCTAGG + Intronic
1055336994 9:75242587-75242609 GCAAATAATTTAGCTTCTCTGGG - Intergenic
1055473875 9:76642277-76642299 GTACATTACTTACCTTCTCTGGG - Intronic
1055530917 9:77182470-77182492 ATAAATAATTTATAATCTCTGGG - Intronic
1055603848 9:77947910-77947932 GCAACTTACTTAAAATCTCTGGG + Intronic
1055672216 9:78618976-78618998 GCAAATTACTTAACTTCTCTGGG + Intergenic
1056083138 9:83117994-83118016 GTAGATCACTTAATGTCTCTGGG + Intergenic
1056196729 9:84236390-84236412 GTAAGTTACTTAGCATCTGTTGG + Intergenic
1056230979 9:84543432-84543454 ACAAATCACTTAACCTCTCTGGG - Intergenic
1057402604 9:94738022-94738044 GAAAGTATCTTAACTTCTCTGGG + Intronic
1057467327 9:95327030-95327052 AAAAAAAAATTAACATCTCTAGG + Intergenic
1058051151 9:100407999-100408021 GGAAGTCACTTAACCTCTCTGGG + Intergenic
1058186253 9:101859125-101859147 GCAAGTTACTTAACTTCTCTGGG + Intergenic
1058569164 9:106322442-106322464 GCAATTTACTTAACCTCTCTGGG + Intergenic
1058877844 9:109259613-109259635 GCAAGTCACTTAACATCTCTGGG + Intronic
1058894153 9:109385318-109385340 GCAAATTACTTAACTTCTTTGGG + Intronic
1059410044 9:114126035-114126057 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1059463702 9:114451857-114451879 GCAAGTTACTTAACCTCTCTGGG + Intronic
1060002353 9:119969899-119969921 GAGCATAACTTAACTTCTCTGGG + Intergenic
1060006234 9:120002320-120002342 GCAAATATCCTAACATTTCTGGG + Intergenic
1060154400 9:121309139-121309161 GTAAGTCACTTCACTTCTCTGGG + Intronic
1060252045 9:121994508-121994530 ACAAATTACTTGACATCTCTGGG - Intronic
1061247255 9:129406892-129406914 GCAAATTATTTAACCTCTCTTGG + Intergenic
1062316530 9:135970003-135970025 GGCAATCACTTAACTTCTCTGGG + Intergenic
1186086648 X:5997766-5997788 TTAATTGACTTAACCTCTCTGGG - Intronic
1186483532 X:9914611-9914633 GTAAATAAGTAAATAACTCTAGG - Intronic
1186935222 X:14442558-14442580 GTAAATGAAATAACATCTTTTGG + Intergenic
1187258876 X:17667077-17667099 ATAAGTCCCTTAACATCTCTAGG - Intronic
1187769938 X:22683841-22683863 GTAAGTTACATAACTTCTCTTGG + Intergenic
1187827535 X:23346930-23346952 GTCAGTCACTTAACCTCTCTGGG + Intronic
1189048066 X:37614296-37614318 GCAATTAAATCAACATCTCTGGG + Intronic
1189346722 X:40247546-40247568 GTAAATTAATTAACCTCTCTGGG + Intergenic
1189438992 X:41017739-41017761 CTAAATCATTTAACCTCTCTTGG - Intergenic
1189507597 X:41627665-41627687 GTAAATCATTTAACCTCTCTAGG + Intronic
1189557123 X:42156396-42156418 AGAAATTACTTAACCTCTCTGGG - Intergenic
1190421054 X:50284935-50284957 GTGACTGACTTAAAATCTCTGGG - Intronic
1190727592 X:53199964-53199986 GTAAATCATTTAACGTCTCTGGG + Intronic
1191992070 X:67049108-67049130 GTAAGTTACTTAACTTCTGTAGG + Intergenic
1192054782 X:67761886-67761908 GCAAATTCCTTAACATCTCTGGG + Intergenic
1192077378 X:68013322-68013344 GTAAGTTTCTTAACCTCTCTAGG - Intergenic
1192111139 X:68366197-68366219 GCAAGTCACTTACCATCTCTAGG + Intronic
1192206763 X:69101486-69101508 ATAAGTCACTTAACCTCTCTTGG - Intergenic
1192860414 X:75063053-75063075 GCAAATCACTTAACTTTTCTGGG - Intronic
1193621726 X:83761051-83761073 GGTAGTAACTTAACATCTCTGGG - Intergenic
1194806722 X:98338196-98338218 GCAAGTCACTTAACTTCTCTAGG + Intergenic
1194960558 X:100230468-100230490 GTAACTCACTTAACGTCTCTGGG + Intergenic
1195423676 X:104703770-104703792 GCAAATGACTTAACATCTCTCGG - Intronic
1195509173 X:105694515-105694537 GCAAATGATTTAACCTCTCTGGG - Intronic
1195925106 X:110017153-110017175 GCAAATCACTTCACCTCTCTGGG - Intronic
1196022402 X:111003929-111003951 GCAAATTATTGAACATCTCTTGG + Intronic
1196119258 X:112030988-112031010 GTAAATAGCTTGACATCACATGG + Intronic
1196624312 X:117860799-117860821 GAAAGTCACTTAACTTCTCTGGG + Intergenic
1196654245 X:118200354-118200376 GCAAAGTACTTGACATCTCTAGG + Intergenic
1197145362 X:123166336-123166358 GTAAATCACTTAGTCTCTCTTGG + Intergenic
1197156940 X:123280962-123280984 GTAAGTCACTTAGCATCTCTAGG - Intronic
1197541116 X:127762912-127762934 ATAAATACCTGAACCTCTCTGGG - Intergenic
1197631514 X:128866385-128866407 ACAAATAACTTAACATTTCTGGG + Intergenic
1198439764 X:136651766-136651788 GTAAATAACTTCACCTTTCTGGG + Intronic
1198513265 X:137375615-137375637 GAAAGTCACTTAACCTCTCTGGG + Intergenic
1198776361 X:140183634-140183656 GCAAATTAGTTAACATCTCCAGG + Intergenic
1199792755 X:151170291-151170313 GCAAGTGACTTAACCTCTCTGGG + Intergenic
1200300545 X:154970284-154970306 GCAAATTAATTAACCTCTCTGGG - Intronic
1201264106 Y:12189338-12189360 TAAAATAATTAAACATCTCTCGG - Intergenic