ID: 1122079370

View in Genome Browser
Species Human (GRCh38)
Location 14:99256499-99256521
Sequence TAAAAAGCAGCAGCCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122079370_1122079375 -3 Left 1122079370 14:99256499-99256521 CCAGCACAGGCTGCTGCTTTTTA 0: 1
1: 0
2: 3
3: 23
4: 262
Right 1122079375 14:99256519-99256541 TTAGGGAACCCAGGCTGGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 243
1122079370_1122079379 16 Left 1122079370 14:99256499-99256521 CCAGCACAGGCTGCTGCTTTTTA 0: 1
1: 0
2: 3
3: 23
4: 262
Right 1122079379 14:99256538-99256560 CAGGCCCTCCTTTCTCCCCCAGG 0: 1
1: 0
2: 3
3: 47
4: 448
1122079370_1122079374 -8 Left 1122079370 14:99256499-99256521 CCAGCACAGGCTGCTGCTTTTTA 0: 1
1: 0
2: 3
3: 23
4: 262
Right 1122079374 14:99256514-99256536 GCTTTTTAGGGAACCCAGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 279
1122079370_1122079384 25 Left 1122079370 14:99256499-99256521 CCAGCACAGGCTGCTGCTTTTTA 0: 1
1: 0
2: 3
3: 23
4: 262
Right 1122079384 14:99256547-99256569 CTTTCTCCCCCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 47
4: 405
1122079370_1122079383 24 Left 1122079370 14:99256499-99256521 CCAGCACAGGCTGCTGCTTTTTA 0: 1
1: 0
2: 3
3: 23
4: 262
Right 1122079383 14:99256546-99256568 CCTTTCTCCCCCAGGCCTCCTGG 0: 1
1: 1
2: 5
3: 67
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122079370 Original CRISPR TAAAAAGCAGCAGCCTGTGC TGG (reversed) Intronic
901790908 1:11653432-11653454 GAAAAAGCAGGAGCCAGTTCTGG + Intronic
902039843 1:13484559-13484581 TAGAAGGCAGGGGCCTGTGCCGG - Intronic
903327455 1:22577559-22577581 TGAACAGAAGCAGCCTGTTCAGG - Intronic
904468612 1:30722455-30722477 AAGAAGGCAGCACCCTGTGCTGG + Intronic
905629232 1:39509704-39509726 GGAAAAGCACCAGGCTGTGCGGG - Intronic
905668522 1:39776479-39776501 GTAAAAGCACCAGGCTGTGCGGG + Intronic
906490032 1:46261048-46261070 AAGAAAGCAGCAGGCTGTGCAGG - Intronic
907378560 1:54065565-54065587 TAAAAATCAGCAGAGTGTGGTGG + Intronic
909407579 1:75309290-75309312 TAAAAATCAGCTGCATGTGGTGG + Intronic
912444058 1:109720910-109720932 GAAAACACAGCAGCCTGTGTTGG + Intronic
913049819 1:115107544-115107566 TAAAAAGTAGAGGCCTGAGCTGG + Intergenic
913556634 1:119973794-119973816 AAGAAAGCACCAGCCTGGGCTGG + Intronic
914846454 1:151286448-151286470 GACACAGCAGCAGCCTCTGCTGG + Exonic
915727123 1:158025822-158025844 TAATTAGCAGCAGCCTCTCCTGG - Intronic
917988333 1:180345995-180346017 TGAAAACCAGCAGCAAGTGCTGG + Intronic
918385436 1:184002478-184002500 TACAAAGCAGCAGCCTGCCTAGG - Intronic
918513109 1:185333142-185333164 TGAAAAGCAGCTTCCTGTCCTGG - Intergenic
918648701 1:186932446-186932468 TAAAAAGTAGCTGGGTGTGCTGG - Intronic
920138376 1:203789098-203789120 GGAATAGCAGCAGCCTGTCCAGG - Intergenic
920972198 1:210752582-210752604 TAAAAAGAAGATTCCTGTGCTGG + Intronic
922009210 1:221564286-221564308 TATAAAGAAGCAGCCTTGGCCGG + Intergenic
922755104 1:228091835-228091857 AAACAAGCAGCAGCTTGTGCAGG + Intronic
923545543 1:234920620-234920642 ATAAAAGAAGCAGCCAGTGCAGG + Intergenic
924368343 1:243320467-243320489 AAAAAAGCAGCAGCCTTGGAGGG - Intronic
1063603339 10:7501342-7501364 GAAGAAGCAGCTGCCTGTGAAGG - Intergenic
1064112172 10:12549006-12549028 TAAAAATTAGCAGCGTGTGGTGG - Intronic
1064203520 10:13303398-13303420 TAAAAAGCATCAGTTTGGGCCGG - Intergenic
1064766433 10:18679227-18679249 TAGAAAGAACCAGCCTGTGTTGG + Exonic
1065572051 10:27081156-27081178 AAAAAAGCAACAACCTGTTCAGG + Intronic
1065737662 10:28769109-28769131 TAAAAACCAACAGCTTGTCCAGG - Intergenic
1065824010 10:29553281-29553303 TAAAAAGCAGCAGCATGGCCGGG + Intronic
1066230943 10:33432631-33432653 GAAAAAGAAGCAGCCTTGGCCGG + Intergenic
1067284751 10:44899339-44899361 TAGAAAGCAGCAGCCCAGGCCGG - Intergenic
1067842126 10:49689218-49689240 TTAAGAGGAGCAGCCTGTGGAGG + Intronic
1068120112 10:52776101-52776123 TAAGAAGCAGGAGTCTGTTCTGG + Intergenic
1068702637 10:60036258-60036280 TAAGCAGCAGCAGCCAGTGATGG - Intronic
1069774022 10:70916483-70916505 AAAAAAGGAGGAGCCTCTGCAGG - Intergenic
1070299491 10:75192876-75192898 TAAAAATCAGCTGCGTGGGCTGG - Intergenic
1070787770 10:79171952-79171974 TAAAAAGCAGTGCTCTGTGCTGG - Intronic
1071528086 10:86369702-86369724 GAAAAAGCAGTCACCTGTGCTGG - Intergenic
1071606159 10:86992353-86992375 GAAAAAGAAGCAGCATCTGCAGG + Intergenic
1072636708 10:97183015-97183037 TGACAAGCAGCAGAATGTGCTGG + Intronic
1072838590 10:98744229-98744251 TAGAAAGCAGCAGACAGGGCTGG + Intronic
1073673551 10:105619270-105619292 CAAAAAGCTGCAGTCTGTGAAGG + Intergenic
1074723988 10:116289060-116289082 TAAAAAGCACCACCCTGGCCGGG + Intergenic
1076399768 10:130174327-130174349 TAAGAAGCAGCAGCCTGGGGTGG + Intronic
1076440442 10:130477541-130477563 AACAATGCAGCAGCCTGTGGGGG + Intergenic
1076984224 11:223706-223728 GAGGGAGCAGCAGCCTGTGCAGG - Intronic
1077297998 11:1834994-1835016 TGACTAGCAGCAGCCAGTGCTGG - Intronic
1077637120 11:3850742-3850764 TAAAAATCAGCAGGGTGTGGTGG - Intergenic
1081600275 11:44488120-44488142 TAAGAAGCAGCTGGCTCTGCGGG + Intergenic
1081616831 11:44596230-44596252 TGGGAAGCAGCTGCCTGTGCAGG + Intronic
1083356830 11:62072735-62072757 TAAAAATTAGCAGGATGTGCTGG - Intergenic
1084127061 11:67106228-67106250 GAAAGAGCACCTGCCTGTGCGGG - Intergenic
1084181581 11:67449462-67449484 CCAAATGCAGCAGGCTGTGCAGG - Intergenic
1087327837 11:96745162-96745184 TAAAGAGCAGCATCCTCTGTAGG - Intergenic
1088212252 11:107469715-107469737 GAAAAATCAGCAGCCTCTGGGGG - Intergenic
1088899048 11:114101155-114101177 TAAAAATTAGCAGGCTGTGGTGG - Intronic
1088921878 11:114265364-114265386 TGAGAAGCAGCAGCCAGTGAGGG - Intronic
1089623873 11:119739209-119739231 CAGAAAGCAGCAGCCAGGGCAGG + Intergenic
1089871062 11:121673016-121673038 CAAAGAACTGCAGCCTGTGCAGG + Intergenic
1091085011 11:132713024-132713046 GAAAAAGCAGGCGCCTGTGTTGG - Intronic
1092183326 12:6461050-6461072 TCAAAAGCAGGAGGCTGTGATGG - Intronic
1092946306 12:13457427-13457449 TAAAAATTAGCTGGCTGTGCTGG - Intergenic
1093777011 12:23087444-23087466 TAAAGACCAGAATCCTGTGCAGG + Intergenic
1095252503 12:39995831-39995853 CAAAGAGCGGCAGCTTGTGCAGG - Intronic
1095696493 12:45149726-45149748 TAAAAAGCACCCACCTGTCCTGG - Intergenic
1095745020 12:45648382-45648404 TAAACAGAATCAGCCTGTGGTGG + Intergenic
1097342410 12:58454159-58454181 TAAAAGGCAGGAGAATGTGCAGG - Intergenic
1098434260 12:70451969-70451991 TAAAAATTAGCAGGGTGTGCTGG - Intergenic
1098620436 12:72591076-72591098 TAATAGGCAGGAGACTGTGCAGG + Intronic
1099484436 12:83211002-83211024 TAAAAATATCCAGCCTGTGCAGG + Intergenic
1100533335 12:95481130-95481152 TAAACATAAGCAGCCTCTGCTGG + Intronic
1102407843 12:112689490-112689512 TACAAATCAGCAGCCTGGGTTGG - Intronic
1103543785 12:121685213-121685235 TAAAAAGAAGCAAACTGTCCAGG + Intergenic
1104988125 12:132608948-132608970 GAACAGGCAGCTGCCTGTGCTGG + Intronic
1105305004 13:19161976-19161998 TAGGAAGCAGCAGGCTGAGCAGG + Intergenic
1105312714 13:19227338-19227360 GGAAAAGCAGCAGCGTGAGCAGG - Intergenic
1105364376 13:19751361-19751383 GGAAAAGCAGCAGCGTGAGCAGG - Exonic
1105612270 13:21978750-21978772 TAAAAAGCAGCCGAGTGTGGAGG - Intergenic
1105787261 13:23761826-23761848 TAAAAAACAGAAGCTTGGGCCGG + Intronic
1106025283 13:25950094-25950116 TAAAAATAAGCAGTCTGGGCTGG - Intronic
1106113407 13:26796739-26796761 TAAAAATTAGCAGGCTGTGGTGG + Intergenic
1107721535 13:43253531-43253553 TGAAATGCACCAGCCAGTGCTGG - Intronic
1107765610 13:43730938-43730960 TAAAGAGCAGCAGCTGCTGCAGG - Intronic
1108731281 13:53238382-53238404 TACAAAGCAGCAGCCTGTCCAGG + Intergenic
1111434625 13:88190826-88190848 AAAAAATCAGCAGGGTGTGCTGG - Intergenic
1111472899 13:88707938-88707960 CAAACAGCAGAAGCCTGTGTGGG + Intergenic
1112347216 13:98600203-98600225 TAAAAATCAGCAGGGTGTGGTGG - Intergenic
1112566154 13:100552803-100552825 TAAAAAGCTGCAGCCTGGTGGGG + Intronic
1113737341 13:112688553-112688575 TAAATAGCAGCACCCTTTGAAGG - Intergenic
1113780078 13:112971571-112971593 TAAAACACAGCAGCATGTCCTGG - Intronic
1115214173 14:30998083-30998105 TAAAAATCAGCAGCCACTGGAGG + Intronic
1115699004 14:35930589-35930611 TAAAAAGCAGCACCTTGAGGTGG + Intronic
1117518251 14:56524007-56524029 AATCAAGCAGCAGCCTGGGCTGG - Intronic
1118502715 14:66378299-66378321 TAGAAAGCAGCAGTCTCGGCTGG + Intergenic
1120808421 14:88777678-88777700 TAAAAAGCAGGAGGATGGGCCGG + Intronic
1122079370 14:99256499-99256521 TAAAAAGCAGCAGCCTGTGCTGG - Intronic
1125486021 15:40111416-40111438 TAAAAAGTAGCTGGCTGTGGTGG - Intergenic
1127495045 15:59502873-59502895 AAAAAAGAAGCAGGCTGGGCAGG - Intronic
1127807897 15:62537923-62537945 TTAAGAGCAGCAGCCTTGGCTGG + Intronic
1129572748 15:76706528-76706550 TAAAAATCAGCAGACTGGGAAGG + Intronic
1129942743 15:79512554-79512576 TAAAAAGGACCAGCTTGTCCAGG + Intergenic
1129942807 15:79512913-79512935 TAAAAAGGACCAGCTTGTCCAGG + Intergenic
1130628015 15:85535950-85535972 AAAAAAGCAGCAGGGTGTGGTGG - Intronic
1131553211 15:93375469-93375491 GAGAAACCAGCAGCCTGTGTGGG - Intergenic
1133330315 16:4968934-4968956 TAATAAGAAGCAGCCTGTGAAGG + Intronic
1135769579 16:25206938-25206960 TAAAAACCAGAAGCCTTGGCTGG - Intergenic
1136132084 16:28229318-28229340 TAAAAATCAGCTGCATGTGGTGG + Intergenic
1136181097 16:28552884-28552906 TAAAAATCAGCAGAATGTGCTGG + Intergenic
1138661348 16:58519907-58519929 TCAGTAGCAGCAGCCAGTGCTGG - Intronic
1139443421 16:66980665-66980687 TAAAAATCAGCTGCGTGTGGTGG - Intergenic
1140609128 16:76577117-76577139 TAAAAAGCAGCGGCCTGTGGGGG + Intronic
1141524308 16:84601858-84601880 GACAAAGCAACAGCCTCTGCTGG + Intronic
1143059526 17:4188135-4188157 AAACAAGCAGCAGCCTCTGGTGG + Intronic
1145036984 17:19548089-19548111 TGAAGAGCAGCAGGATGTGCTGG - Exonic
1148605777 17:48927935-48927957 TACACAGCAGCTGCCTGTGTTGG - Exonic
1149403161 17:56319675-56319697 TCATAAGAAGCAACCTGTGCTGG + Intronic
1149810471 17:59665070-59665092 TAAAAATCAGCTGCATGTGGTGG + Intronic
1152005175 17:77676049-77676071 CAAAAGGCAGGAGCCTGGGCTGG - Intergenic
1152331540 17:79676136-79676158 TAAAAATTAGCTGGCTGTGCTGG + Intergenic
1153635546 18:7109886-7109908 TAAAAAGCAGCCGGCTGGCCGGG + Intronic
1154086870 18:11314048-11314070 TAAAAATCAGCAGGGTGTGGTGG + Intergenic
1154152093 18:11914335-11914357 AAAGAAGCAACCGCCTGTGCTGG - Intergenic
1154273630 18:12940952-12940974 TATCAAGCAGGAGCCTGTGGTGG - Intergenic
1155222271 18:23696312-23696334 GAAAAAGTAGCAGCATGTTCTGG + Intronic
1156018101 18:32569118-32569140 TAGAAAGCAGAAGTCAGTGCGGG + Intergenic
1156517795 18:37695839-37695861 ATAAAAGCAACAGCCTTTGCTGG - Intergenic
1157898959 18:51495238-51495260 TAGAAAGTAACAGCCTGTGATGG - Intergenic
1158653791 18:59310244-59310266 TAGAGAGCAGTAGCCTATGCAGG + Intronic
1162211998 19:9099672-9099694 TAAAAATTAGCAGGCTGTGGTGG + Intergenic
1162574953 19:11493864-11493886 TAAAAATCAGCTGGCTGTGGTGG + Intronic
1163037085 19:14576451-14576473 TCAAAACCAGCAACCTGTTCAGG - Intergenic
1163283882 19:16334146-16334168 TAAAAATTAGCCGGCTGTGCTGG - Intergenic
1163419951 19:17208788-17208810 GAACAAGCAGCAGCCCCTGCAGG + Intronic
1163656734 19:18550472-18550494 TAAAAAGCAACAGCCTGGCCGGG + Intergenic
1164743529 19:30594493-30594515 AAAAAGGCAGCAGCTAGTGCTGG - Intronic
1165010835 19:32845196-32845218 TAAAAAACAGGAGCCTGAGCTGG + Intronic
1166104965 19:40593393-40593415 TAAAAAGTAGCTGGCTGTGGTGG - Intronic
1166117578 19:40665150-40665172 AAAAAAGCATCAGGCTGTGAGGG - Intergenic
1166674251 19:44730075-44730097 TAAAAAGCAGCTGGGTGTGGCGG + Intergenic
1167448486 19:49553516-49553538 CAAAAACCAGCTGGCTGTGCTGG + Intergenic
1168400785 19:56085169-56085191 TACAAACCAGTAGCCTGGGCAGG + Intergenic
925131743 2:1498505-1498527 TGGAAACCAGCAGCCTGGGCTGG + Intronic
926368413 2:12155309-12155331 TAAAAGTCAGCAGCCTTTGTAGG - Intergenic
928774637 2:34745595-34745617 TAAAAATCATCATCCTGTACTGG - Intergenic
929462146 2:42110433-42110455 TAAAAAGCAACTGTCTGTGATGG - Intergenic
929552422 2:42903108-42903130 TGAAAAGAAGCCGCCAGTGCTGG - Intergenic
931765851 2:65455899-65455921 CCAAAAGCAGCTGCCTGTGAAGG - Intergenic
933802279 2:85971474-85971496 TAAAAAGCAGCAGCCAGGCATGG - Intergenic
934724520 2:96607029-96607051 AGAAAAGCAGCAAACTGTGCTGG + Intronic
937214938 2:120306509-120306531 TTAAAAAGAGCAGCCTGGGCCGG + Intergenic
937467576 2:122148158-122148180 TAAAAAGCAGCAGATGGTTCAGG + Intergenic
937710816 2:124978310-124978332 CACACAGCAGCAGCCTGGGCAGG - Intergenic
938293815 2:130164312-130164334 TAAGAAGCAGCAGGCTGAGCAGG + Intronic
938370669 2:130766467-130766489 AAAAAAGCAGCAGCAGATGCTGG - Exonic
938462729 2:131508650-131508672 TAAGAAGCAGCAGGCTGAGCAGG - Intergenic
940419726 2:153465950-153465972 AAACAAGCAGCAGCCTGCTCAGG - Intergenic
940537095 2:154959058-154959080 TAAAAACCAGCAGGATGTGGTGG - Intergenic
941477282 2:165965655-165965677 TAAAAAGCAAGAGCCTGGGCCGG - Intergenic
941597072 2:167490765-167490787 TAAAAAGCAGCAGACACTGTAGG - Intergenic
941931522 2:170945346-170945368 TAAAAATCAGCTGCGTGTGGTGG + Intronic
943904045 2:193475214-193475236 TAAAAGGCAGGAGCATGGGCTGG + Intergenic
944122901 2:196260198-196260220 TAAAAACTAGCAGTCTGTGAAGG + Intronic
948706168 2:239794016-239794038 TCAAAGACAGCAGCCTGCGCTGG - Intronic
1170843346 20:19941442-19941464 TAAAAAGCAGCACCAAGTGAAGG - Intronic
1171064765 20:22003993-22004015 TAAAAATCAGCTACCTCTGCAGG - Intergenic
1171188556 20:23141701-23141723 CAAAGAGCAGCAGCAGGTGCAGG + Intergenic
1171507062 20:25645656-25645678 TAAAAATTAGCAGGCTGTGGTGG - Intergenic
1172464516 20:35146365-35146387 TGACAAGCAGCAGCCAGTGATGG + Intronic
1172647179 20:36477917-36477939 TAAAAAGCTGCAACTTGTGGAGG - Intronic
1173009548 20:39169400-39169422 TGACAGGCAGCAGACTGTGCAGG - Intergenic
1174373649 20:50111634-50111656 CAAAAGGCAGCAGCTTGTGGTGG + Intronic
1174598760 20:51707063-51707085 TGCAAAGCTGCAGCCTGTGACGG - Intronic
1174830677 20:53809309-53809331 TAGAAGGCAGCAGCCTCTGGAGG - Intergenic
1176083115 20:63283859-63283881 TCACAAGCAGCAGCCGGAGCCGG + Exonic
1176799218 21:13406924-13406946 AAAAAAGCAGCAACCTATTCAGG + Intergenic
1177202602 21:17974423-17974445 CAAAAATCAGCAGCATGTGGTGG - Intronic
1179025725 21:37676870-37676892 GAGAAAGCAGCAGGCTCTGCAGG + Intronic
1179627496 21:42657031-42657053 TAAACAGCAGCAGACGTTGCAGG + Intronic
1181088337 22:20455298-20455320 AAGACAGCAGTAGCCTGTGCTGG - Intronic
1181172035 22:21015294-21015316 CAAACTGCAGCAGCCTCTGCAGG - Exonic
1181177270 22:21044906-21044928 CAAACTGCAGCAGCCTCTGCAGG + Intergenic
1181485871 22:23231553-23231575 AAAATACCAACAGCCTGTGCTGG + Intronic
1181645641 22:24230403-24230425 TAAAAATCAGCGGCGTGTGGTGG + Intronic
1182304399 22:29357980-29358002 TTAAAAACAGCTGCCTGGGCCGG - Intronic
1182320553 22:29476147-29476169 TAAAAAGGAACAGGCTGTGCAGG + Intergenic
1184301656 22:43564293-43564315 CAAAAATCAGCAGGGTGTGCTGG + Intronic
1185318151 22:50187681-50187703 TAAAAAACAGCAGGCTGGGCTGG + Intronic
951846464 3:27089848-27089870 TGAAGAGCAGCAGCCCATGCAGG + Intergenic
952996693 3:38889980-38890002 AAAAAAGCAGCAGCAGCTGCAGG + Intronic
953465927 3:43119560-43119582 TAAAAATGAGCAGCCTGTGTTGG - Intergenic
955827431 3:62963126-62963148 CAAAAAGCCCCAGCCTGTGGGGG - Intergenic
957174549 3:76789349-76789371 TACGAAGGAGCAGCCTGCGCTGG + Intronic
959169021 3:102822327-102822349 AAAAAAGCAGCAGCCACTCCAGG - Intergenic
959338700 3:105099671-105099693 TAAGAAGCAGCAAGGTGTGCTGG + Intergenic
960164323 3:114384668-114384690 TAAAAACCAGAAGGCTCTGCTGG - Intronic
962210945 3:133477103-133477125 GAAACAGCAAGAGCCTGTGCTGG - Intergenic
962674778 3:137747139-137747161 TAAAGAGCAGAAGTCTGTTCTGG - Intergenic
962815368 3:138992622-138992644 TGAAAAGCAGGAGCCTGTTCTGG - Intergenic
964144859 3:153447457-153447479 AAAAAAGCAGCAGCATATGATGG + Intergenic
966313933 3:178624975-178624997 GAAAAAGCAGCAGGCTGCCCAGG + Intronic
966651201 3:182303144-182303166 TAAAAATCCCCAGACTGTGCTGG + Intergenic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
968543351 4:1179727-1179749 TAAAAACTAACAGCCTGAGCTGG + Intronic
969933801 4:10660874-10660896 TAAAAAGCTGCAAGCTGTGAGGG - Intronic
975662648 4:76703062-76703084 AAAAAAGCAGCAGCCAGAGCAGG + Intronic
979992542 4:127392160-127392182 CAAATGGCAGCAGCCTGGGCTGG + Intergenic
981492236 4:145352095-145352117 AGAAAGGCAGCAGGCTGTGCTGG - Intergenic
982647070 4:158037488-158037510 CACAAATCAGCAGCCTGAGCTGG + Intergenic
985833080 5:2250387-2250409 TAAAAAGCAGCTGCCACTGTTGG + Intergenic
988546897 5:32166518-32166540 TAAAAAGCAGCAGCATGGCCGGG + Intronic
990702375 5:58487996-58488018 TAGAAAGCAGAAGCCTGGTCTGG - Intergenic
993353543 5:86879305-86879327 AAAAAAGCAGCAGCATGCCCAGG + Intergenic
993443277 5:87981046-87981068 GAAAAGGCAGCTGCCTGAGCTGG + Intergenic
993478767 5:88397040-88397062 TAGAAATTAGCAGCCTGTCCTGG + Intergenic
995688470 5:114797381-114797403 CAAAAAGAAGCAGCCTATTCTGG - Intergenic
996354548 5:122581366-122581388 TAAAAAGAAATAGCCTATGCTGG - Intergenic
997098325 5:130939108-130939130 TTAAGAGCAGCAGCCTCAGCAGG - Intergenic
997123110 5:131196470-131196492 TTAAAAGGAGCAGGCTGAGCTGG + Intronic
998148623 5:139744699-139744721 TAAATAGCAGGAGGCTGGGCTGG - Intergenic
1001543789 5:172557641-172557663 TGAAACTCAGCAGCCTTTGCAGG - Intergenic
1002373634 5:178773567-178773589 AAAAAAGCAGGTGCCTGTGGTGG + Intergenic
1002920853 6:1572119-1572141 TTAAGAGCAGCATCCTGGGCAGG + Intergenic
1007479791 6:42142420-42142442 GAAAAAGAAGCAGACGGTGCAGG - Exonic
1008602269 6:53107766-53107788 TAAGAAGCAGTAGCTTGGGCCGG + Intergenic
1009562656 6:65269352-65269374 TAAAAGGGAGCAACCTGTGGAGG + Intronic
1011067786 6:83346857-83346879 TAAGAAGTAGCAGACTGTACTGG - Intronic
1011159497 6:84372603-84372625 TAAAAGGCAGCAGTGTGTCCTGG - Intergenic
1011676623 6:89741077-89741099 CAAAAATTAGCAGACTGTGCTGG + Intronic
1013506959 6:110810477-110810499 TGAAAAGCAGCAGCATGGCCAGG + Intronic
1013974462 6:116060845-116060867 TTAAAGGCAACAGCCTCTGCTGG - Intergenic
1014172561 6:118295019-118295041 TAAATGTCAGCAGCCTGTGCTGG + Intronic
1014730136 6:125022708-125022730 GAAAAATCAGCATCCTGTTCTGG - Intronic
1014736932 6:125104522-125104544 TAAAAAGCAGCTGGCTCTGCAGG + Intergenic
1015416565 6:132955942-132955964 TAAAAATCAGCTGGCTGTGGTGG - Intergenic
1016485289 6:144530686-144530708 TAAAAAGATGCAGCCTTTTCTGG - Intronic
1016561959 6:145406158-145406180 CAAAAAGCAGCAGACTTTGGTGG - Intergenic
1016853491 6:148643443-148643465 AAAACAGCAGCAGCCGCTGCAGG - Intergenic
1018234285 6:161707799-161707821 AAAAAAGCAGCAGGCAGTGACGG - Intronic
1018345627 6:162896245-162896267 TAAACAGCAGGAGAATGTGCTGG - Intronic
1018856062 6:167676232-167676254 CAAAAAGCAGCAAACAGTGCTGG - Intergenic
1019433240 7:1009344-1009366 GAACGGGCAGCAGCCTGTGCTGG + Intronic
1020098891 7:5383361-5383383 TAGAATGCACCTGCCTGTGCAGG - Intronic
1020951448 7:14683393-14683415 CCAAAAGCAACAGCCTTTGCTGG + Intronic
1026173122 7:67972122-67972144 TAAAAATCAGCAGGGTGTGGTGG + Intergenic
1027202458 7:76072459-76072481 CAAAAAGCAGGAGCCTGGCCTGG + Intergenic
1028022211 7:85791307-85791329 TGCAAAGCAGCAGCCTGGGCTGG + Intergenic
1028520406 7:91724147-91724169 TAAAATTCAGCAGCCTGGCCGGG + Intronic
1030216341 7:107046676-107046698 TAAGAAGCAGCAGCCAGTAACGG + Intronic
1031165091 7:118218101-118218123 TAAGAAGCAGCAGCTTTTCCTGG - Intronic
1032358202 7:131229706-131229728 AAAAAATCAGCAGCCTGTGGAGG - Intronic
1032483561 7:132265808-132265830 TAGAAGCCAGCAGCCAGTGCAGG + Intronic
1032653501 7:133903861-133903883 TGACAAGCAGCAGCCAGTGAAGG + Intronic
1032989136 7:137371783-137371805 TCAATGGCAGCAGCTTGTGCTGG - Intergenic
1033021084 7:137724978-137725000 TAAAAAGAAGCAGCCAGTGATGG + Intronic
1035786193 8:2263200-2263222 TATAATGCAGCAGCCAGTACAGG - Intergenic
1035806614 8:2458516-2458538 TATAATGCAGCAGCCAGTACAGG + Intergenic
1036709473 8:11068941-11068963 TGAAAAGGAGCAGCCTGGGGAGG - Intronic
1038887977 8:31687063-31687085 TAAAAGGGAGCATCCTGGGCCGG - Intronic
1043385074 8:79740458-79740480 TAAAAGTCATCAGCCTGTACAGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1045027724 8:98104376-98104398 TTAAAAGAAGTAGCCTGGGCAGG - Intronic
1047762659 8:127965683-127965705 CAAAAGGCAGCAGGCGGTGCAGG - Intergenic
1048072041 8:131031244-131031266 CAAAAAGCAGCTCCCTGGGCAGG + Intronic
1048491602 8:134898973-134898995 TAAAAATCAGCTGCCTGTGCGGG - Intergenic
1048694480 8:137010092-137010114 TAAAAAGCAGCAATTTATGCAGG - Intergenic
1048982710 8:139711660-139711682 GAAATAGCAGCGGCGTGTGCAGG - Intergenic
1050955904 9:11659656-11659678 TAAAAATCAGCATCCTCAGCTGG + Intergenic
1051247306 9:15124946-15124968 TCAAAAACAACAGCCTGTCCAGG + Intergenic
1052802925 9:32986786-32986808 TAAAAAACAGCTGGGTGTGCTGG - Intronic
1053234245 9:36438232-36438254 TAAAAAGCAACACCCTTGGCTGG - Intronic
1054845057 9:69785926-69785948 TGAAAACCAGCAGCCTGTAGAGG - Intergenic
1057209163 9:93190292-93190314 TGACAGACAGCAGCCTGTGCAGG + Intronic
1057482707 9:95458087-95458109 TGAACAGCAGCAGCCAGTGGCGG + Exonic
1058048920 9:100387121-100387143 TAAAAATCAGCTGCATGTGGTGG - Intergenic
1058385343 9:104429345-104429367 TCAGAAGCAACAGCCTGGGCTGG - Intergenic
1060679048 9:125545007-125545029 TAAAAAGCAAAAGCCGATGCTGG + Intronic
1061951124 9:133936393-133936415 CAAAAAGCAGCTGGGTGTGCTGG - Intronic
1187553700 X:20331195-20331217 AAAAAAGCAGCAGCATGGACTGG - Intergenic
1190773292 X:53533037-53533059 AAAAAGGCAGTAGCCTTTGCAGG - Exonic
1190826485 X:54022623-54022645 GAAATAGCAGAAGCCTATGCAGG - Intronic
1192364099 X:70456504-70456526 TAAAAAGCTGCAGGTTGTCCAGG + Intronic
1196738513 X:119002949-119002971 TAAAAATTAGCAGACTGTGGTGG - Intronic
1197323012 X:125056566-125056588 TCAGAAGCAGAAGTCTGTGCTGG + Intergenic
1197401264 X:125994031-125994053 TAAAAAGAAGCATCCAGTACTGG - Intergenic
1198082609 X:133253327-133253349 TAAAAAGTAGCATTCTGGGCCGG + Intergenic
1198463488 X:136884548-136884570 GAAAAAGAAGCAGCTTGTGGGGG + Intergenic
1198571294 X:137960077-137960099 TGCTAAGCAGCAGCCTGGGCTGG + Intergenic