ID: 1122080067

View in Genome Browser
Species Human (GRCh38)
Location 14:99260988-99261010
Sequence ACGCTGAAAGTGGGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080067_1122080073 4 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080067_1122080074 5 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080067_1122080078 29 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080067_1122080079 30 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080067 Original CRISPR ACGCTGAAAGTGGGAGGGGA AGG (reversed) Intronic
901434971 1:9241844-9241866 ACGAGGAAACTGGGAGGTGAAGG - Intronic
902626712 1:17680723-17680745 AAGCTGGCAGTTGGAGGGGAGGG - Intronic
902806069 1:18862072-18862094 GCGTGGAAAGTGGGAGGGCATGG - Intronic
903435059 1:23343647-23343669 ATGCAGAATGTGGGAGGGGAGGG + Intronic
904190244 1:28737497-28737519 AGGCTGAAAATGGGAGGCGGGGG - Intronic
905383032 1:37577780-37577802 ACCCTGAATGAGGGAGGGGATGG - Intronic
905474302 1:38215023-38215045 CCCCTTACAGTGGGAGGGGAGGG - Intergenic
906151177 1:43588550-43588572 AGGCTGGAAGTGGGTGGGGTGGG + Intronic
906676315 1:47696051-47696073 AGGCTGAAATTTGTAGGGGAAGG + Intergenic
907859530 1:58338308-58338330 GAGGTGGAAGTGGGAGGGGAAGG - Intronic
908380566 1:63593654-63593676 ACGCTGGTGGTGGGCGGGGACGG + Intronic
909506915 1:76402408-76402430 ACACTGAAAGTGGAAGGAAATGG - Intronic
910286448 1:85560166-85560188 ATGCTAAAAGAGGCAGGGGAAGG + Intronic
912593756 1:110853394-110853416 ATGCTTGAGGTGGGAGGGGAGGG + Intergenic
912596313 1:110880374-110880396 AGGTAGAAAGTGGGAGAGGAAGG + Intronic
915908932 1:159900224-159900246 CCGCTGGAGGTGGGAGGGGCGGG - Intergenic
918128440 1:181604468-181604490 ACATGGAAAGTGGGAGGAGAAGG + Intronic
919110480 1:193213065-193213087 AATCTGAAAGTGGTTGGGGATGG - Intronic
919499937 1:198325343-198325365 AAGATGAAAGTGGGTGGGTAGGG + Intergenic
920938549 1:210458739-210458761 ACGCTGAAAGGTGGAGGGAATGG - Intronic
920975279 1:210780048-210780070 AAGCTGAAGGTGGGTGGGTAGGG + Intronic
921740146 1:218675416-218675438 AAGCTGAAAGTTAGAGGGGTAGG - Intergenic
922902322 1:229146785-229146807 ATGTTGGAAGTGGGAAGGGAAGG - Intergenic
923681737 1:236124067-236124089 AAGCTGAAAGTTGGAGGCCAAGG - Intergenic
924049298 1:240064151-240064173 ATTATGAAAGTGGGAGGGGAGGG + Intronic
924455866 1:244218457-244218479 AAGCTGAATGTGGCAGGGGCGGG + Intergenic
1062833873 10:623671-623693 AGGCTGAAGGGAGGAGGGGAGGG + Intronic
1063010974 10:2021069-2021091 AGGCTGGAAGTGGGAGATGACGG - Intergenic
1063389791 10:5641723-5641745 AGGCTGAAGGCTGGAGGGGATGG + Intronic
1064557951 10:16566475-16566497 AGGCAGAAAGTGGGAGGTGACGG + Intergenic
1066023398 10:31325655-31325677 AATCTGAATGGGGGAGGGGAAGG - Intronic
1066477327 10:35760741-35760763 TGGCTGAAAGTGGCAGGGGAAGG + Intergenic
1067058411 10:43065380-43065402 AGGGTGGAAGAGGGAGGGGATGG + Intergenic
1067502738 10:46820510-46820532 ACGGTGAAAGAGAGAGGGGAAGG + Intergenic
1067591852 10:47519503-47519525 ACGGTGAAAGAGAGAGGGGAAGG - Intronic
1067638967 10:48027576-48027598 ACGGTGAAAGAGAGAGGGGAAGG - Intergenic
1067685271 10:48463218-48463240 AGGTTGGAAGTGAGAGGGGATGG - Intronic
1067801208 10:49360784-49360806 ACCCAGAAAGAGGGAGGGGGTGG + Intergenic
1068585726 10:58796270-58796292 ACAATGAATGGGGGAGGGGAGGG - Intronic
1069596876 10:69677795-69677817 ATGCTGAGTGGGGGAGGGGAGGG - Intergenic
1069679730 10:70275392-70275414 AGGCTTAAGGTGGGAGAGGAGGG + Intronic
1069891157 10:71653222-71653244 ATGCTGTGGGTGGGAGGGGAAGG - Intronic
1070279016 10:75035383-75035405 TGGCTGAGAGTGGGAGTGGAAGG - Intergenic
1070288114 10:75098349-75098371 CCCCTGAAAGTGGGAGGGGACGG - Intronic
1073332435 10:102679141-102679163 GGGCTGGAGGTGGGAGGGGAGGG + Intronic
1074249571 10:111731088-111731110 AGGCTGAGACTGGGAGGGGAGGG - Intergenic
1074446501 10:113525296-113525318 ACCCTGAGAGTGGGAGGGCAAGG + Intergenic
1074944130 10:118264741-118264763 ACGCTTAAAGTGAGAGGGTGAGG + Intergenic
1074974009 10:118565959-118565981 AGAGAGAAAGTGGGAGGGGAGGG - Intergenic
1076132009 10:128019751-128019773 AGGCTGTGAGTGGGATGGGAGGG + Intronic
1076566564 10:131403275-131403297 AAGGAGAATGTGGGAGGGGAAGG + Intergenic
1076605732 10:131688963-131688985 ACGCTGAAATGGGGCAGGGATGG - Intergenic
1077476899 11:2794762-2794784 AAGCTGAAAGTGGGAGATGGGGG - Intronic
1077614491 11:3665358-3665380 ACTCTCAATGTGGGAGGGCATGG + Intergenic
1077682830 11:4260610-4260632 ATTCTGAAAGTGGCAGGGGAAGG - Intergenic
1077687212 11:4306144-4306166 ATTCTGAAAGTGGCAGGGGAAGG + Intergenic
1077809656 11:5624528-5624550 ACCATGAAAGTGGTAGGAGAAGG + Intronic
1078141203 11:8694210-8694232 ACCCTGTCAGTGGGAGAGGAAGG + Intronic
1078360148 11:10661684-10661706 ACGGTGAAAGTCAGAGGAGAAGG - Intronic
1080741076 11:35064775-35064797 AAGCTGAGAGTAGGAGGGCATGG - Intergenic
1081786219 11:45749757-45749779 ACCCTGGAGGTGGGTGGGGAAGG + Intergenic
1083088050 11:60170303-60170325 AGGGTGGAAGTGGAAGGGGAAGG + Intergenic
1083294807 11:61709631-61709653 AGGGTGACAGAGGGAGGGGACGG + Intronic
1083793603 11:65001838-65001860 ACTGGGAAAGTGGGAGGGGCTGG - Intergenic
1083947323 11:65931434-65931456 ATCCAGGAAGTGGGAGGGGAGGG - Intergenic
1084941487 11:72615595-72615617 CAGCTGAAGGTGGGAGGGGGTGG - Intronic
1085393584 11:76194842-76194864 TCCCTGAGGGTGGGAGGGGAAGG + Exonic
1086403564 11:86480972-86480994 ACTCTGAAAGTGGGAGGAGCTGG + Intronic
1087258988 11:95989639-95989661 AGGATAAAAATGGGAGGGGAAGG + Intronic
1087497087 11:98905864-98905886 TGGGTGAAGGTGGGAGGGGATGG - Intergenic
1088121877 11:106379525-106379547 AGGCAGAAAGTGGGAGTGGGGGG - Intergenic
1088172183 11:107010812-107010834 AGCCTGAAAGTGGGAGGGGGAGG - Intronic
1091583399 12:1802178-1802200 ACACTGATTGTGGGAGGTGATGG - Intronic
1092040575 12:5380279-5380301 ACAGTGAAAAGGGGAGGGGACGG + Intergenic
1092161668 12:6318483-6318505 ACGCCGGAAGTGGGAGAAGAGGG + Intronic
1092223009 12:6728135-6728157 GCATTGAAAGTGGGAGGGAAGGG + Intronic
1093185652 12:16016299-16016321 ACTCAGAAAAGGGGAGGGGAAGG + Intronic
1093253866 12:16841749-16841771 AGTCTGAAAGTGGGAGGCGCTGG + Intergenic
1093534783 12:20210199-20210221 AGGTGGGAAGTGGGAGGGGAGGG - Intergenic
1095638796 12:44463116-44463138 ACACAAAAAATGGGAGGGGAGGG + Intergenic
1096668191 12:53180916-53180938 GCGCGGGAAGGGGGAGGGGAGGG + Intronic
1096716177 12:53492958-53492980 CCGCTGAAAGTGGGGAGGAAGGG + Intronic
1096747450 12:53738145-53738167 AGGCTGAAGGTGAGAGGGGAAGG + Intergenic
1097066511 12:56324544-56324566 ACACTTAAAATGGAAGGGGAAGG - Intronic
1097916062 12:65021563-65021585 ACGCTGGCAGTGGGAGGAGGAGG - Intergenic
1098707824 12:73713564-73713586 ATCCTGACAGTGGAAGGGGAGGG - Intergenic
1099105046 12:78486564-78486586 ACTCTGTGGGTGGGAGGGGAAGG + Intergenic
1100332565 12:93598331-93598353 AAGGTGAAGGTGGGAGGAGAGGG + Intergenic
1101754853 12:107613441-107613463 ATGTTGCAAGGGGGAGGGGAGGG - Intronic
1102592204 12:113965404-113965426 AAGCTGAATTTGGGAGGGAAAGG + Intronic
1102620982 12:114194188-114194210 AGGCTGAAAGGGGGAAGGGAGGG + Intergenic
1103119972 12:118372420-118372442 AGACTGAAAGTCTGAGGGGAGGG - Intronic
1103615956 12:122152419-122152441 AGGCTGAACGTGGGAAGAGAGGG - Intergenic
1104407471 12:128530095-128530117 AGGCAGAAAGTGGGCGGGGGTGG + Intronic
1108116820 13:47137890-47137912 ACGCTGAAAGAGAAGGGGGAAGG - Intergenic
1108592170 13:51921891-51921913 ACGCACACAGTGGGTGGGGAGGG - Intergenic
1108956890 13:56169051-56169073 AAGCTGAAAGTGACAGAGGAGGG + Intergenic
1113424361 13:110195869-110195891 ACCCTGTAAGGGAGAGGGGAGGG - Intronic
1113581247 13:111431066-111431088 AGGCTGAAAAGGGGAGGGGAGGG - Intergenic
1113737495 13:112689450-112689472 AGCCTGTCAGTGGGAGGGGAGGG - Intergenic
1114511539 14:23266058-23266080 AGGCTGAACCTGGGAGGCGAAGG - Intronic
1119263409 14:73251254-73251276 ACACTGGGAGTGGGAAGGGATGG - Intronic
1119709749 14:76812977-76812999 ACGCAGGAAGTGGGAGGAGCCGG + Intronic
1119884870 14:78131727-78131749 GCAGTGACAGTGGGAGGGGAGGG + Intergenic
1122080067 14:99260988-99261010 ACGCTGAAAGTGGGAGGGGAAGG - Intronic
1122414528 14:101542632-101542654 TCACTGCAAGGGGGAGGGGAGGG - Intergenic
1122879075 14:104681960-104681982 AGGCGGGAAGTGGGAGGGGCTGG + Intergenic
1124117081 15:26854708-26854730 CCACTCAAGGTGGGAGGGGAGGG - Intronic
1124499272 15:30212344-30212366 ACTCAGGAAGTGGGTGGGGAAGG + Intergenic
1124810583 15:32933845-32933867 AGGCTGAAAGTGAAAAGGGATGG - Intronic
1125851486 15:42907652-42907674 AGGCTGAAAAGGGGAGGGGAAGG + Intronic
1126935025 15:53697330-53697352 CCACTGAAAGTGAGAGAGGAAGG - Intronic
1127507716 15:59611185-59611207 AAGAAGAAAGGGGGAGGGGAGGG - Intronic
1127507725 15:59611209-59611231 AAGAAGAAAGGGGGAGGGGAGGG - Intronic
1128025812 15:64435779-64435801 TGGCTGGAAGTGGGATGGGAGGG + Intronic
1128146843 15:65336756-65336778 AGCCTGTAACTGGGAGGGGAGGG - Intronic
1128317462 15:66670119-66670141 TCCCTGAATGTGGGAGAGGAGGG + Intronic
1128326182 15:66725671-66725693 GGGCTGAAATTGGGAGGGGCAGG + Intronic
1128369551 15:67030322-67030344 GCACAGAAAGTGGGAGGGAAAGG + Intergenic
1128559898 15:68657952-68657974 TGGCTGAAAGTTGGTGGGGAGGG + Intronic
1128691547 15:69727969-69727991 ACCCTGGAAAGGGGAGGGGAGGG - Intergenic
1131110248 15:89760391-89760413 GAGCTGAAGGTGTGAGGGGAGGG - Intergenic
1131120725 15:89822042-89822064 AAGGTGGAAGTGGGAGGGGCAGG + Intergenic
1132300256 15:100770977-100770999 GGGCTCAGAGTGGGAGGGGAAGG - Intergenic
1133717438 16:8463428-8463450 AGGCAGAAAGTGGGGTGGGAGGG + Intergenic
1133790289 16:9004445-9004467 ACTCTGGAAGTGGGAGGGGGAGG - Intergenic
1134026107 16:10955272-10955294 ATGCTGAATGGGGCAGGGGATGG - Intronic
1135010547 16:18873860-18873882 AAGGAGAAAGTGGGTGGGGATGG - Intronic
1135311055 16:21404792-21404814 CCGCTGAGGGTGGAAGGGGATGG + Exonic
1135317421 16:21461445-21461467 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1135364006 16:21837243-21837265 CCGCTGAGGGTGGAAGGGGATGG + Exonic
1135370319 16:21893257-21893279 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1135441470 16:22477444-22477466 AAGGAGAAAGTGGGTGGGGATGG + Intergenic
1135447835 16:22534105-22534127 CCGCTGAGGGTGGAAGGGGATGG - Exonic
1135499109 16:22978353-22978375 AGGGAGGAAGTGGGAGGGGAGGG + Intergenic
1135531071 16:23255146-23255168 ACTCTAAGAGTGGGAAGGGAGGG + Intergenic
1136307779 16:29383902-29383924 CCGCTGAGGGTGGAAGGGGATGG + Exonic
1136321174 16:29485332-29485354 CCGCTGAGGGTGGAAGGGGATGG + Exonic
1136435855 16:30225302-30225324 CCGCTGAGGGTGGAAGGGGATGG + Exonic
1138058660 16:53864057-53864079 CCAATGAAAGGGGGAGGGGAAGG - Intronic
1139473979 16:67193307-67193329 AGGCTAAGAGTGGAAGGGGAGGG - Intronic
1139476849 16:67207084-67207106 CAGCTGAAGCTGGGAGGGGAGGG + Intergenic
1139889142 16:70236670-70236692 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1141802424 16:86319913-86319935 ACGTTGGAATTGGGAGGGCAAGG - Intergenic
1141802447 16:86320035-86320057 ATGCCGAAGGTGGGAGGGGGCGG - Intergenic
1142139526 16:88466579-88466601 ATCCTGGCAGTGGGAGGGGATGG + Intronic
1142249605 16:88985343-88985365 CCGCGGAAAGTGAGAGGGGTCGG + Intergenic
1142418608 16:89956857-89956879 GAGCTGCAAGGGGGAGGGGAGGG + Intronic
1143423119 17:6811745-6811767 AAGCTGAAACAGAGAGGGGAAGG - Intronic
1144783566 17:17819760-17819782 AGGTTGAAAGTGGGAGAGGGAGG - Intronic
1144913013 17:18698492-18698514 AGTGTGAACGTGGGAGGGGATGG + Exonic
1145233881 17:21195014-21195036 TCTCTGAAATTGGGTGGGGATGG + Intergenic
1146265491 17:31450145-31450167 AGGCTGAGAATGGCAGGGGAAGG - Intronic
1146783388 17:35696489-35696511 AGGCTGAACCTGGGAGGCGAAGG - Intronic
1147216246 17:38900823-38900845 CCTCTGGAAGTTGGAGGGGAAGG - Intronic
1147758589 17:42783571-42783593 AAGGTGAAAGGGGGAAGGGATGG - Intronic
1147945401 17:44077673-44077695 AGGGTGAAAGTGTGTGGGGAAGG - Exonic
1147994350 17:44352996-44353018 CCACTGAAACGGGGAGGGGATGG - Exonic
1148013660 17:44505585-44505607 ATGCTGAAAATGGGAGGATATGG + Intergenic
1148466358 17:47867405-47867427 ATTCTGACAGTGGGAGGGCAGGG + Intergenic
1148701147 17:49587737-49587759 AGGGTGAAAGTGGGAAAGGATGG + Intergenic
1148783739 17:50135238-50135260 AGGCTGGAAGGGGGAGGGGTGGG + Exonic
1150462946 17:65367981-65368003 AGGCAGAAAGGGAGAGGGGAAGG + Intergenic
1150471662 17:65442612-65442634 AGGCTGGAAGAGGGAGAGGAGGG + Intergenic
1150842154 17:68618773-68618795 ACTCTGAAAGTGGCAATGGAGGG - Intergenic
1150947650 17:69765505-69765527 AAGAGGAAAGGGGGAGGGGAAGG - Intergenic
1151187588 17:72375248-72375270 CCGCTCACAGTGGGAGGGGTGGG - Intergenic
1151549001 17:74810641-74810663 ACCCAGAGACTGGGAGGGGATGG - Intronic
1152390899 17:80003114-80003136 AAGAGGAAAGTGGGAGGGCAGGG + Intronic
1152551248 17:81031418-81031440 AGGCAGAAGGTGGGAGGGGGAGG + Intergenic
1152926138 17:83088593-83088615 ACACAGGCAGTGGGAGGGGAGGG + Intronic
1152930478 17:83107186-83107208 AAGCTGAAAGAGGCAGGGCAGGG + Intergenic
1155131660 18:22940753-22940775 ACTCTGAAGGTGGAAGCGGAAGG - Intronic
1155611137 18:27669162-27669184 ACACTGACAGTGGGAGGGGAGGG - Intergenic
1156470318 18:37373702-37373724 ACTCTAACAGTGGGAGGGGCTGG + Intronic
1158761096 18:60387842-60387864 AGTCAGAAAGTGGGAGGAGAGGG + Intergenic
1161853520 19:6751149-6751171 AGGCGGAAAGAGGGAGGCGAGGG + Exonic
1162328745 19:10013929-10013951 ATGCTGAGAGTGGCAGGGGGTGG + Intronic
1162934599 19:13975429-13975451 ACTCTGAAGGTGGCAGGGGAGGG + Intronic
1164561168 19:29293240-29293262 AGGCTAAAAGTGGCAGGGGTTGG - Intergenic
1165313398 19:35041377-35041399 ACGCAGAAAGGGCGGGGGGAAGG + Intronic
1166562343 19:43741391-43741413 ATGGTGCATGTGGGAGGGGAGGG + Intronic
1167024333 19:46904204-46904226 AAGCTGAAGGGGAGAGGGGAAGG - Intergenic
1167244244 19:48364276-48364298 AGGCGGAAAGAGGGAGGGGGCGG + Intergenic
1168150480 19:54444823-54444845 GCGCAGAAGGTGGGAGGGGCTGG + Intergenic
925698384 2:6607005-6607027 ACTCTGACAGTGGGAGGCAAGGG + Intergenic
926312564 2:11685265-11685287 ACGGGAAAAGTGGGAGGAGATGG + Intronic
926320314 2:11744740-11744762 TCCCTGGAGGTGGGAGGGGAGGG + Intronic
926777981 2:16440958-16440980 TCCCTTAAAGTGGAAGGGGAAGG + Intergenic
927197436 2:20558247-20558269 ACGTTGACGGTGGGTGGGGAAGG + Intergenic
927596364 2:24401528-24401550 TGGCTGAAAGTGGGAAGGAAAGG + Intergenic
927645992 2:24877285-24877307 AGGCTGAAGGGGGGAGGGGTGGG - Intronic
931199449 2:60083322-60083344 ACACTCAAAGTTGGTGGGGAGGG - Intergenic
931664461 2:64600324-64600346 AGGCTGACAGTGGGTGGGGCAGG - Intergenic
932412880 2:71557620-71557642 ACAGTGATAGTGGGAGGGGTGGG + Intronic
932629625 2:73328211-73328233 ATGATGAAAGTTGGAGGTGATGG - Intergenic
932804152 2:74768666-74768688 ACCCAGAAAGAGGGAGGGGAGGG - Intergenic
934777785 2:96950042-96950064 ACGGGGAAAGAGGCAGGGGAAGG + Intronic
935431120 2:102977047-102977069 TCCCTCAAAGGGGGAGGGGATGG - Intergenic
936339297 2:111617213-111617235 ACAGTAAAAATGGGAGGGGAGGG - Intergenic
936757480 2:115731945-115731967 AAGGTGATAGTGGGAGGGTAAGG - Intronic
937481073 2:122260041-122260063 AAGATGAAGGTGGGAGTGGAGGG - Intergenic
938115525 2:128600784-128600806 AGGCAGAAAGGGGGAGGGAAGGG - Intergenic
938310261 2:130284907-130284929 ACCCTGCAAATGGGACGGGAAGG - Intergenic
940655366 2:156481456-156481478 AAGCTGGAAAGGGGAGGGGAGGG - Intronic
942166307 2:173244124-173244146 ACGCAGCAAGTGGGAGGGAGGGG + Intronic
943566001 2:189517566-189517588 AGGCCTAAAGCGGGAGGGGAAGG + Intergenic
943970784 2:194403791-194403813 ACACTGTCAGAGGGAGGGGAAGG - Intergenic
944967128 2:204947564-204947586 AGGCTAAGAGAGGGAGGGGAGGG - Intronic
946847176 2:223869765-223869787 AAGCTGATAGTGGCAGGGGCAGG + Intronic
948586057 2:239020564-239020586 ACACTGAGAGTGGGAGGCGGCGG + Intergenic
948594153 2:239068639-239068661 CAGCTGAAAGAGGGACGGGACGG + Intronic
948599274 2:239099224-239099246 AGACTGAAGGTGGTAGGGGATGG + Intronic
1170072346 20:12382242-12382264 ATACTGAAAGTGGTTGGGGATGG + Intergenic
1170672644 20:18449211-18449233 ACTCTAAAAGTGGGAAGGGTGGG + Intronic
1170934347 20:20796857-20796879 AGGCAGAAAGTGGGTAGGGAGGG + Intergenic
1170982928 20:21231692-21231714 AAGCAGAAAGTGGGCTGGGAGGG + Intronic
1171011847 20:21513321-21513343 ACGCTGGGAGTGAAAGGGGAAGG - Intronic
1172131603 20:32659687-32659709 ACTCTGAGAATGAGAGGGGAAGG + Intergenic
1176377242 21:6092723-6092745 AGGCTGGAAGTGAGAGGGGCCGG - Intergenic
1176778197 21:13160234-13160256 ACGCTGCTAGAGGGAGAGGAAGG + Intergenic
1177781312 21:25625341-25625363 ATGCAGAAAGAGGGAAGGGAGGG + Intergenic
1178027947 21:28489437-28489459 AGGCTGAGAGTGGGAGGACATGG + Intergenic
1178298685 21:31432631-31432653 ATGCATGAAGTGGGAGGGGAAGG + Intronic
1179218641 21:39387858-39387880 AAGCTGGAAGGGGGAGGGGGGGG + Intronic
1179272852 21:39865126-39865148 AGGCTGAAAGTGTGAGGTCAAGG + Intergenic
1179586153 21:42375359-42375381 AGGGAGAAAGTGGGAGGGGGCGG - Intronic
1179592793 21:42421271-42421293 ATGATGAGAGTGGGAGGAGAAGG + Intronic
1179608064 21:42531094-42531116 TCGCTGCCAGTGGGAGGGGTGGG + Intronic
1179631259 21:42680084-42680106 AGGCTGTGAGAGGGAGGGGAGGG - Intronic
1179746233 21:43445521-43445543 AGGCTGGAAGTGAGAGGGGCCGG + Intergenic
1180833094 22:18915969-18915991 AGGCGGAATCTGGGAGGGGAGGG + Intronic
1181066731 22:20310285-20310307 AGGCGGAATCTGGGAGGGGAGGG - Intergenic
1181269721 22:21652166-21652188 CCGCTGACAGTCGGAGGGGCCGG - Intergenic
1182434740 22:30323193-30323215 AAGCTGAAAGTGGCAGGGCATGG - Intronic
1183619824 22:38965907-38965929 AGGCTGAAAGGGGGAGAGAAAGG - Intronic
1183922870 22:41183206-41183228 ACACTGAAAAGTGGAGGGGAAGG + Intergenic
1184600236 22:45539121-45539143 AGGAGGGAAGTGGGAGGGGAGGG - Intronic
1184919223 22:47593921-47593943 AGGCTGAAAGTCGGAGGCCAGGG - Intergenic
1185048238 22:48539902-48539924 AGGCAGAAGGTGGGAGGGGATGG + Intronic
1185084707 22:48734279-48734301 ACGCTGACATGGGGAGTGGAGGG + Intronic
1203283178 22_KI270734v1_random:141273-141295 AGGCGGAATCTGGGAGGGGAGGG + Intergenic
949597281 3:5561488-5561510 AGGCTGAATCTGGGTGGGGATGG + Intergenic
950425658 3:12923612-12923634 AGGCTCAGAGTGGGAGGGGCTGG - Intronic
951008406 3:17646894-17646916 ACTCAAAAAGTGGGAGGGGTTGG - Intronic
952781099 3:37099983-37100005 TTTTTGAAAGTGGGAGGGGAGGG + Intronic
953213778 3:40898695-40898717 AGGCTGAAGGTGGAAGGGGAAGG + Intergenic
954529676 3:51308144-51308166 ACTGTGGAGGTGGGAGGGGAAGG + Intronic
954573878 3:51664000-51664022 GGGGTGAAGGTGGGAGGGGAGGG + Exonic
954886918 3:53882709-53882731 ATGGTGAAAGTGAGAGGGGAGGG - Intergenic
954972701 3:54664475-54664497 ATGCTGAAAGGGGGAGGTGGCGG - Intronic
955604320 3:60684200-60684222 AAGCTGAAAGTGGCAAGGAATGG - Intronic
956534506 3:70260719-70260741 AATCTGAAAGTGAAAGGGGAGGG - Intergenic
956980799 3:74634970-74634992 AGGCTGAAACTGGGAGGTGGAGG - Intergenic
957657774 3:83103724-83103746 AGGCTGAACCTGGGAGGCGAAGG + Intergenic
958913812 3:100025437-100025459 TTTCTGAAAGTGGGTGGGGAAGG - Intronic
959794472 3:110407720-110407742 AAGAAGAAAGTGGGAGGTGATGG - Intergenic
959933076 3:112003362-112003384 AAGCAGGAAGAGGGAGGGGAAGG + Intronic
960619640 3:119625825-119625847 ACGCTTGAAGTGAGAGGGCAAGG + Intronic
960812257 3:121636336-121636358 AGGCTGGGAGAGGGAGGGGACGG - Intronic
961343595 3:126246639-126246661 CCGCTGGAGATGGGAGGGGAGGG + Intergenic
961463113 3:127065552-127065574 ACGCTGAAGGAGGAAGGGGAGGG - Intergenic
962304858 3:134277014-134277036 ACAGTGAGAATGGGAGGGGAGGG + Intergenic
962314600 3:134351216-134351238 TCACTGAAAGTGGGAGAGGTGGG - Intergenic
963881432 3:150533196-150533218 ACTCTGAATATGGAAGGGGAAGG - Intergenic
964347344 3:155767602-155767624 TCGCTGAAACTGGGAAGGCATGG - Exonic
967651078 3:191988001-191988023 AAGCTGAAGGTGGGGGTGGAGGG - Intergenic
968817224 4:2828385-2828407 AGCCTGAAGGTGGGAGTGGATGG - Intronic
969143656 4:5101349-5101371 TCTCTGAAAGAGAGAGGGGAGGG + Intronic
971135039 4:23859359-23859381 ATGCTGAAAGTGTAAGGGGAAGG + Intronic
972247418 4:37259811-37259833 AGGCAGAGAGTGGGAGGAGAAGG + Intronic
972929635 4:44055800-44055822 TCTCTGCAAGTGGAAGGGGATGG - Intergenic
975782772 4:77857363-77857385 ACGCTGAAAGATGGAGGCAATGG + Intergenic
975834299 4:78405760-78405782 ACTCTGATAGTGGGAGGGAGAGG - Intronic
978405111 4:108371020-108371042 ACGCTGAAGGTTAGAGGGAAGGG + Intergenic
979830061 4:125288439-125288461 ACTCTCAAAGTGGGGAGGGAGGG - Intergenic
981937711 4:150252969-150252991 TCCCAAAAAGTGGGAGGGGAAGG + Intronic
982488252 4:155995451-155995473 AAGCTGAAAGTGGGTGTGGTTGG - Intergenic
982914552 4:161189629-161189651 ACCCTGGAAGTGGGATCGGAAGG + Intergenic
984766958 4:183407111-183407133 ACGCTGCAAGTGGTTGTGGAGGG + Intergenic
985578393 5:684225-684247 ACGCTGACTGAGGGAGCGGAGGG + Intronic
988908991 5:35820763-35820785 ACGATTAAAGTGGGAGAAGAGGG + Intergenic
990879478 5:60523383-60523405 CCGGTGAAAGTTGGAGGGAAAGG - Intergenic
992964970 5:81990401-81990423 TGGCAGAATGTGGGAGGGGAAGG + Intronic
993701853 5:91128088-91128110 AGGCAGAGAGAGGGAGGGGAGGG - Intronic
994133801 5:96262274-96262296 GTGCTGAAAGTGGGTTGGGAGGG + Intergenic
994386359 5:99137506-99137528 AAGCTGAAAGGGGTAGGGGTAGG - Intergenic
995366203 5:111364146-111364168 GCTTTGGAAGTGGGAGGGGATGG + Intronic
996734710 5:126748047-126748069 AGGCAGAAAGTGGGAGGACACGG + Intergenic
996795639 5:127343564-127343586 TCTCTGAAAGTGGGAGGAGTGGG - Intronic
997294546 5:132761495-132761517 GCGCTGCAAGTTGGAGGAGATGG - Exonic
998367347 5:141639906-141639928 ACCCGGAACCTGGGAGGGGAGGG - Exonic
999591573 5:153153800-153153822 AGGCAGAAAATGAGAGGGGATGG + Intergenic
999932721 5:156451093-156451115 ATGGTGAAAGAGGGAAGGGAAGG - Intronic
999949044 5:156628769-156628791 AGGGAGGAAGTGGGAGGGGATGG + Intronic
1000815882 5:165921151-165921173 ACACTCAGAGTGGGTGGGGATGG - Intergenic
1001255827 5:170183014-170183036 GGGCTGAGAGTGGGAGGAGAAGG - Intergenic
1001404147 5:171463706-171463728 GGTCTGAAAGTGGGAGGGGGTGG + Intergenic
1001938708 5:175726153-175726175 AGGCTGGGAATGGGAGGGGAAGG + Intergenic
1002346544 5:178551910-178551932 AAGGTGGCAGTGGGAGGGGAGGG - Intronic
1002694474 5:181075319-181075341 ACGAGGAAAGAGGGAAGGGAAGG + Intergenic
1002947820 6:1779648-1779670 ACGCTGTTCTTGGGAGGGGATGG - Intronic
1003889980 6:10555622-10555644 AAGCTGGAAGTGAGAGGAGAGGG + Intronic
1004093562 6:12530112-12530134 AGGGTGTAAGTGGGAGGAGAGGG - Intergenic
1004139342 6:13001272-13001294 AAGCTGAGAGTGGGATGAGATGG - Intronic
1007093988 6:39202242-39202264 ATGCTGGAAGTGGTTGGGGATGG - Intronic
1007635650 6:43298254-43298276 ACTCTGGAGGTGGGAGTGGATGG - Exonic
1009296333 6:61953820-61953842 ACTCAGAAAGAGTGAGGGGAAGG + Intronic
1011551969 6:88538323-88538345 CCTCTGAATGTGGGAGAGGAGGG + Intergenic
1014468622 6:121786700-121786722 ACACTGGCAGTGGTAGGGGAGGG - Intergenic
1015953419 6:138576479-138576501 AGCCTGACAGTGAGAGGGGAGGG - Intronic
1018484823 6:164230413-164230435 ACGCTGCTTGTGGGATGGGATGG - Intergenic
1019018252 6:168896302-168896324 AGTCTGAAGGTGGGAGTGGAGGG - Intergenic
1020151561 7:5685598-5685620 GAGCTAAAAGTGAGAGGGGAGGG + Intronic
1020379899 7:7532167-7532189 CTGCTGAAAGTGGGAGGAAATGG + Intronic
1020432976 7:8132374-8132396 AACTTGAAAGTGTGAGGGGAGGG - Intronic
1020988401 7:15165222-15165244 ATGCTAAAAGTGGGGAGGGAGGG + Intergenic
1022337017 7:29431657-29431679 ACAGTGAAAGTGGGAGTGAATGG + Intronic
1023721229 7:43097077-43097099 ATGGCCAAAGTGGGAGGGGAAGG - Intergenic
1023754204 7:43400879-43400901 AAGCTGAAAGTGGCAAGGGATGG - Intronic
1024973075 7:55088251-55088273 ACGCTGAAGGTAGGAGCGGATGG + Intronic
1025622393 7:63185948-63185970 AGGCTGAAAGGGAGAGGAGAGGG - Intergenic
1026072076 7:67130806-67130828 ATGCAGACTGTGGGAGGGGAGGG - Intronic
1026704827 7:72681456-72681478 ATGCAGACTGTGGGAGGGGAGGG + Intronic
1030167157 7:106566820-106566842 ACGTTGAAAGAGGGAGAAGAAGG - Intergenic
1030329205 7:108255177-108255199 CCGTGGAAAGTGGGAGGGGCAGG - Intronic
1032037495 7:128531252-128531274 GCGCCGACAGTGGGAGAGGAGGG - Intergenic
1033830399 7:145244779-145244801 AGGCTGACAGTAGCAGGGGAAGG - Intergenic
1034475604 7:151279858-151279880 CTGGTGACAGTGGGAGGGGAAGG - Intergenic
1035596759 8:864355-864377 ACGATGAAAGTAGGAGATGATGG + Intergenic
1035816848 8:2550464-2550486 AGGCTGAAATTGGGCGGGCACGG + Intergenic
1036658896 8:10695082-10695104 AGGCTGGATGGGGGAGGGGAAGG + Intronic
1037477192 8:19269546-19269568 AGGCTGAGAGTGGCAGAGGAAGG - Intergenic
1037590218 8:20305542-20305564 ACTGAGAAAGAGGGAGGGGAAGG - Intergenic
1038003016 8:23406415-23406437 AAGCTGAACCTGGGAGGGGGAGG - Intronic
1038259399 8:25979896-25979918 TTGCTAAAAGGGGGAGGGGATGG - Intronic
1038693856 8:29787598-29787620 TAGCTGAAAGTAGGAGGGTAGGG + Intergenic
1039863098 8:41476609-41476631 CCTCTGAAGGTGGGAGGGAAGGG + Intergenic
1040413979 8:47181281-47181303 AGGCTGCAAGGGGGTGGGGATGG - Intergenic
1041191631 8:55361278-55361300 ACGTTGAGAGGGGGAGAGGAGGG + Intronic
1041469901 8:58197107-58197129 ACTCTGAAATAGGGAGGGTAGGG + Intronic
1042052418 8:64725661-64725683 ATGCAGAGAGTGGGAGAGGAAGG + Intronic
1042526073 8:69766301-69766323 ATGCTGTGAGTGGGATGGGAAGG - Intronic
1043066017 8:75570809-75570831 AAGCTGATAGGGGCAGGGGAGGG + Intergenic
1045127127 8:99104563-99104585 AGGATGAAAGGGAGAGGGGAGGG - Intronic
1046099690 8:109600340-109600362 AGGCTGGAAGTAGGAGTGGAAGG - Intronic
1047299011 8:123596903-123596925 TCACTGGAAGTGGGAGGTGATGG + Intergenic
1047542692 8:125785570-125785592 ACACTGAAACAGGGAGGGGCAGG - Intergenic
1048026329 8:130590380-130590402 ACACTGAAAGTGGCTGGGGAAGG - Intergenic
1048691236 8:136966340-136966362 ACTCTTAAATTGGGAGAGGAAGG - Intergenic
1051078405 9:13267734-13267756 AAGCTGAAAGGGAGAAGGGATGG + Intronic
1051249733 9:15147201-15147223 ACCCTGAAAGTGGTAGGAAATGG + Intergenic
1051518942 9:17962243-17962265 ACTCTAAAACTGGGAGGGCAAGG + Intergenic
1053474512 9:38372418-38372440 ACTGGGAAATTGGGAGGGGATGG + Intergenic
1056108527 9:83371800-83371822 AGGATGGAAGAGGGAGGGGAAGG + Intronic
1056134994 9:83622938-83622960 AAGAGGAAAGAGGGAGGGGAGGG + Intergenic
1057043346 9:91863946-91863968 ATGCTGGAAATGGGAAGGGAAGG + Intronic
1057231892 9:93326078-93326100 ACACTGAGTGGGGGAGGGGAGGG + Intronic
1057524014 9:95783852-95783874 AGGCTGAAACTGGGAAGGAAAGG - Intergenic
1057903722 9:98968421-98968443 AAGCTGAAAGTGGCAAGGAATGG - Intronic
1059009574 9:110441985-110442007 AGGCTGAAAGAGGGAAGGCAAGG - Intronic
1059911277 9:119046833-119046855 AGGCTGAAGGTCAGAGGGGAAGG - Intergenic
1060191177 9:121593961-121593983 ACTATGAAAGTGGGAGGGCTGGG - Intronic
1060454100 9:123774008-123774030 ACAGTGAAAGAGGAAGGGGAAGG + Intronic
1060749104 9:126157198-126157220 AGACAGAAAGTGGGAGGAGAGGG - Intergenic
1060874491 9:127071981-127072003 AGGCTGAAGGTGGGAGAGGAGGG - Intronic
1061042854 9:128149839-128149861 AGGCTGAGAGGGGGTGGGGATGG - Intronic
1061218098 9:129233453-129233475 AGGCTGAGAGTGGGAGTGCAGGG + Intergenic
1061541290 9:131278903-131278925 ACGCTGAGTGTGTGAGGGCAGGG + Intergenic
1061600747 9:131668561-131668583 TCTGTGAAAATGGGAGGGGAGGG - Intronic
1062334948 9:136060939-136060961 AAGGTGAAAGGGGGAGGGGAGGG + Intronic
1186459948 X:9740040-9740062 AAGGAGAAAGTGGGAGGAGAGGG + Intronic
1186915258 X:14212293-14212315 GCTATAAAAGTGGGAGGGGATGG - Intergenic
1186978769 X:14936700-14936722 AAGCTGAGAGTAGGAAGGGAAGG - Intergenic
1188602823 X:31989959-31989981 ACTCCGAAAGGAGGAGGGGAGGG - Intronic
1189195408 X:39148221-39148243 AACCTGAAAGTGGGAAGGGGTGG + Intergenic
1190713175 X:53083652-53083674 ATGGTGAAAGGAGGAGGGGAGGG + Intronic
1191677578 X:63807889-63807911 ACGCTGCAAGTTGTAGGGCAGGG - Intergenic
1192040260 X:67613019-67613041 ACGTAGAAAGTGGGTGTGGAAGG - Intronic
1195282330 X:103348319-103348341 ACGCTGGAAGGGGAAGGGGCCGG - Intergenic
1195996785 X:110739613-110739635 ACAATGAATGTGGGAGTGGAGGG - Intronic
1196748335 X:119091931-119091953 ACTCAGAAAGTGGGAAGGGTAGG + Intronic
1196892000 X:120300211-120300233 AAGCTGAAAGAGACAGGGGAGGG - Intronic
1198257255 X:134934474-134934496 ATGCAGATATTGGGAGGGGAGGG + Intergenic
1198719416 X:139599580-139599602 CCTCTGAAAGTGGGAGGTAAAGG + Intronic
1200586320 Y:5008954-5008976 ACTCTGAAAGTGGAAGGGACCGG + Intronic
1200740341 Y:6847062-6847084 ACCCAGAAAGTGTAAGGGGATGG - Intergenic