ID: 1122080068

View in Genome Browser
Species Human (GRCh38)
Location 14:99260992-99261014
Sequence TTCAACGCTGAAAGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080068_1122080078 25 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080068_1122080074 1 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080068_1122080073 0 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080068_1122080080 27 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080068_1122080079 26 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080068 Original CRISPR TTCAACGCTGAAAGTGGGAG GGG (reversed) Intronic
903504619 1:23824825-23824847 TTCTGCGCTGAGAATGGGAGAGG + Intronic
904832114 1:33312002-33312024 GTCAAAGCTGTGAGTGGGAGGGG - Intronic
906151175 1:43588546-43588568 TTCTAGGCTGGAAGTGGGTGGGG + Intronic
908992761 1:70113072-70113094 TTCAAGGCTCAGAATGGGAGAGG + Intronic
909386875 1:75068020-75068042 TTCAGTGTAGAAAGTGGGAGGGG + Intergenic
912933282 1:113982711-113982733 CACAACGCTGGAGGTGGGAGTGG - Intergenic
919124173 1:193376505-193376527 ATCAAGGCTGGAAGTGGAAGTGG - Intergenic
921759010 1:218890420-218890442 TTCAACATTGAAAGAGAGAGTGG + Intergenic
924370255 1:243340384-243340406 ATCAACCCTGAACGTGGGAAGGG + Intronic
1064002656 10:11676397-11676419 TTAAACACTGAAAGAGGAAGAGG + Intergenic
1077982461 11:7314400-7314422 TTCAACCCTACCAGTGGGAGTGG + Intronic
1080600794 11:33819253-33819275 TGCAACCCTGAAAGAGGGAGGGG - Intergenic
1084769009 11:71330560-71330582 CTCCACGCTGAAGGTTGGAGAGG + Intergenic
1088203906 11:107370630-107370652 TTAAACACTGAAAATGGAAGTGG + Intronic
1091872050 12:3900649-3900671 ATCAATCCTGAAACTGGGAGAGG + Intergenic
1099462502 12:82940806-82940828 TTCACATCTGAAAGTGGGAGAGG - Intronic
1100579138 12:95922094-95922116 TTCAGTGTAGAAAGTGGGAGTGG + Intronic
1104554046 12:129783978-129784000 TTCAATGCTGGAAGAGGGAACGG - Intronic
1105465749 13:20638009-20638031 TTCAGGGCTTCAAGTGGGAGGGG + Intronic
1106457987 13:29944289-29944311 TTCAGCGATGAAGGAGGGAGAGG + Intergenic
1107991154 13:45820167-45820189 TTCAACCCTGAATTTAGGAGGGG + Intronic
1108956888 13:56169047-56169069 ATCAAAGCTGAAAGTGACAGAGG + Intergenic
1110278789 13:73668602-73668624 TTCAACTTTGGAAGTGGAAGAGG + Intergenic
1110860347 13:80340275-80340297 TTCGGCGCTGAGAGCGGGAGAGG - Intronic
1112050964 13:95643878-95643900 TTCAGAGCTGAACGTGGGGGTGG + Intronic
1114190695 14:20437626-20437648 GACAACTCTGAAAGTAGGAGGGG - Intergenic
1115023695 14:28714715-28714737 TCCAATGCTGAGAGTGGGATGGG - Intergenic
1116865244 14:50026570-50026592 TTCACCCCTGAAAGTGGTATAGG - Intergenic
1119758718 14:77136665-77136687 TTGAGAGCTAAAAGTGGGAGGGG - Intronic
1122080068 14:99260992-99261014 TTCAACGCTGAAAGTGGGAGGGG - Intronic
1123576929 15:21679882-21679904 TTCAAAGATGGAAGTGGGACAGG + Intergenic
1125323005 15:38508697-38508719 TTCAAACCTGGAAGTGGGAACGG + Intronic
1126418065 15:48439833-48439855 TTGAACTTTGCAAGTGGGAGTGG + Intronic
1128139694 15:65290133-65290155 TTCAACACTGAAGGTGCAAGTGG + Intronic
1202985797 15_KI270727v1_random:414127-414149 TTCAAAGATGGAAGTGGGACAGG + Intergenic
1135782853 16:25320905-25320927 TTCAAAGCAGGAAGTGAGAGTGG + Intergenic
1140949788 16:79805918-79805940 TCCATCTCTGACAGTGGGAGGGG + Intergenic
1145990108 17:29074239-29074261 TGCATCCCTGAGAGTGGGAGGGG - Exonic
1149846045 17:60009766-60009788 GACACCGCAGAAAGTGGGAGGGG + Intergenic
1150084394 17:62266346-62266368 GACACCGCAGAAAGTGGGAGGGG + Intergenic
1150471660 17:65442608-65442630 TTAAAGGCTGGAAGAGGGAGAGG + Intergenic
1157659699 18:49429520-49429542 TTCACCTCTGAAACTGGCAGAGG + Intronic
1166971636 19:46572475-46572497 TTGAACGCTGAAGGTGGAGGTGG + Intronic
1168150479 19:54444819-54444841 GTCAGCGCAGAAGGTGGGAGGGG + Intergenic
929919234 2:46160844-46160866 TTCCACGGTGGGAGTGGGAGTGG + Intronic
932816168 2:74864009-74864031 TTCAATGCCAAAACTGGGAGAGG - Intronic
943424850 2:187718578-187718600 TGCAACCCTGAAATTTGGAGAGG - Intergenic
946185833 2:217979902-217979924 TTCAAAGCTGGAAGGGGGTGGGG - Intronic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
948234042 2:236374043-236374065 ATCAAAGCTGAAACTAGGAGGGG - Intronic
1170471173 20:16669731-16669753 TTCAAGGCTGAAAGTGGAAGTGG + Intergenic
1178189955 21:30268877-30268899 TTCAAATCAGAAGGTGGGAGGGG - Intergenic
1178602038 21:34002860-34002882 TGCAGCGCTCAGAGTGGGAGAGG + Intergenic
949234531 3:1792502-1792524 TTCAAAGCAGAAAATGGGGGAGG + Intergenic
953337887 3:42109452-42109474 TTCAACTGTGAAAGTGCTAGAGG + Intronic
955281109 3:57596020-57596042 TTCAACGTTCAAAGTTAGAGGGG + Intronic
957688359 3:83534259-83534281 TTCAACTCTAAAAGTTGGTGAGG - Intergenic
959551848 3:107668980-107669002 TTAACCTCTGAATGTGGGAGGGG - Intronic
959906402 3:111715777-111715799 TCCAACGCTGAAAAGGGCAGTGG - Intronic
962774463 3:138645984-138646006 TTCCATGCTGAATGTGGGAGTGG + Intergenic
966136071 3:176699535-176699557 TTTAATGCTGAAACTGGGAAAGG - Intergenic
969899523 4:10336155-10336177 TTCAAGTGTGAAAGTGGGAGAGG - Intergenic
970178914 4:13367226-13367248 TTCAAAGCAGAAAGGGGCAGTGG + Intronic
970262886 4:14247639-14247661 ATCAATTCTGAAAGGGGGAGGGG - Intergenic
971190074 4:24419526-24419548 TCCAAGGCTGAAATTGGGAGAGG - Intergenic
973850823 4:54960015-54960037 AGCAAGGATGAAAGTGGGAGTGG + Intergenic
975674987 4:76818331-76818353 TCCAATGCTGAAAGTGGGGGTGG + Intergenic
977151964 4:93523699-93523721 TTCATCCCTGACAGTGGCAGTGG + Intronic
977487866 4:97671763-97671785 TTCAACTCTGTAAGTGGGCATGG + Intronic
979539238 4:121861625-121861647 TGCAAGGCTGGAACTGGGAGGGG - Exonic
982384426 4:154784781-154784803 TTCACACCTGAAAGTGGCAGAGG + Intronic
982488253 4:155995455-155995477 ATAAAAGCTGAAAGTGGGTGTGG - Intergenic
985897729 5:2759058-2759080 TTCTACGCTGAGAATGAGAGGGG - Intergenic
986363521 5:7005705-7005727 CTCAAGGCTGAAAGTTAGAGAGG - Intergenic
986431161 5:7682570-7682592 TTCAAGACTGAATCTGGGAGGGG + Intronic
986568755 5:9143768-9143790 TTCAGTGCTTAAAGAGGGAGTGG - Intronic
988673149 5:33403789-33403811 TTGGAAGCTGAAAGTGGGAGAGG + Intergenic
989707210 5:44349156-44349178 CTCAAAGTAGAAAGTGGGAGAGG - Intronic
991113712 5:62929721-62929743 TTCAACACAGAAAGTGAGAAAGG + Intergenic
999152249 5:149433959-149433981 TTCAAAGCTGAAAAAGGAAGAGG - Intergenic
1001150902 5:169226353-169226375 TTCAATCCTGGAAGTGGGAAGGG - Intronic
1004596196 6:17102094-17102116 TTAAGCGCGGGAAGTGGGAGAGG + Intergenic
1022258534 7:28682668-28682690 TTCAAACCTAAAAGTGGGGGGGG + Intronic
1024843682 7:53617745-53617767 TTCAATACTTAAACTGGGAGAGG - Intergenic
1027819052 7:83020351-83020373 TTCCACACTTAAATTGGGAGAGG - Intronic
1031268023 7:119607216-119607238 TTCAAAGCTGAATGTGGGATAGG + Intergenic
1032274755 7:130444880-130444902 TTGAGCGCTGAGGGTGGGAGTGG - Intergenic
1037057504 8:14460517-14460539 TTAAACATTGACAGTGGGAGAGG + Intronic
1039582568 8:38678877-38678899 TTAATCTCTGAGAGTGGGAGTGG - Intergenic
1042262173 8:66870875-66870897 GTCACCGCTGTCAGTGGGAGGGG + Intronic
1047542693 8:125785574-125785596 TGCAACACTGAAACAGGGAGGGG - Intergenic
1047754609 8:127908904-127908926 TTCAAAGCTGAAATTGGATGGGG - Intergenic
1050860142 9:10418608-10418630 TTCTAGGGTGGAAGTGGGAGTGG - Intronic
1055420698 9:76138120-76138142 GTGAGCGCAGAAAGTGGGAGGGG + Intronic
1057988802 9:99745453-99745475 TTCATCTGTGAAAATGGGAGCGG - Intergenic
1060733711 9:126053183-126053205 TTTAACACTGAAACGGGGAGGGG - Intergenic
1186359497 X:8825025-8825047 TGAATTGCTGAAAGTGGGAGAGG - Intergenic
1189345449 X:40237711-40237733 TTCAATGCTGAAAATAAGAGGGG + Intergenic
1192087761 X:68117838-68117860 GTCAAGCCTGAAAGTGCGAGTGG - Intronic
1193467896 X:81869299-81869321 TCCAGGGCTGAAAGTGAGAGTGG - Intergenic
1194927032 X:99837167-99837189 TCCAACTCTGGAAGTGGGAAAGG - Intergenic
1199097473 X:143759356-143759378 TTCAACTTAGACAGTGGGAGGGG + Intergenic