ID: 1122080069

View in Genome Browser
Species Human (GRCh38)
Location 14:99260993-99261015
Sequence TTTCAACGCTGAAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080069_1122080080 26 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080069_1122080074 0 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080069_1122080078 24 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080069_1122080079 25 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080069_1122080073 -1 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080069 Original CRISPR TTTCAACGCTGAAAGTGGGA GGG (reversed) Intronic
904832115 1:33312003-33312025 TGTCAAAGCTGTGAGTGGGAGGG - Intronic
909873353 1:80773053-80773075 AATCAACGCTGCAATTGGGAAGG - Intergenic
917886431 1:179389886-179389908 CTTTAAGGCTGAAAGTGGCAGGG - Intronic
919522341 1:198603771-198603793 TTTCAATGCTTAATGTAGGAGGG - Intergenic
922353652 1:224756287-224756309 TTTCAGTGCTAAAACTGGGATGG + Intergenic
924370254 1:243340383-243340405 TATCAACCCTGAACGTGGGAAGG + Intronic
1062922318 10:1289581-1289603 TTCCACCTCAGAAAGTGGGATGG - Intronic
1065737322 10:28765851-28765873 CTTCAAGGCATAAAGTGGGAGGG + Intergenic
1068069462 10:52178576-52178598 GTTCAACACCGACAGTGGGATGG + Intronic
1077734324 11:4772924-4772946 TTTAATGGCTGAAAGTGTGATGG + Intronic
1078450370 11:11436425-11436447 TTTCAGTGCTGAAACTGGGAAGG - Intronic
1078907665 11:15702916-15702938 TTTCCAGGCAGAAAATGGGAAGG - Intergenic
1080600795 11:33819254-33819276 GTGCAACCCTGAAAGAGGGAGGG - Intergenic
1082314632 11:50702709-50702731 TTTCAACTCTGTAAGTTGAATGG - Intergenic
1084439560 11:69164800-69164822 TTTCAACACTAAAATGGGGAGGG + Intergenic
1088925915 11:114302740-114302762 TTTCAACACAGAAATTGGGAGGG - Intronic
1089267789 11:117278533-117278555 TTTCAGTGCTAAAACTGGGATGG - Intronic
1089623574 11:119737086-119737108 TTTCAGTGCTAAAATTGGGAAGG + Intergenic
1091152708 11:133343533-133343555 TTTCAACCCTGGGAGTGAGAGGG + Intronic
1098671568 12:73236053-73236075 TGCCAATGCTGAAAGCGGGATGG - Intergenic
1100685401 12:96982103-96982125 TTTAAATGCTGAAAGAGGCAAGG + Intergenic
1101208187 12:102509951-102509973 TATCACTGCTAAAAGTGGGAAGG + Intergenic
1101562530 12:105871593-105871615 GTTCAATGCTGAAAGTGGCGTGG - Intergenic
1102900223 12:116630889-116630911 TTTCAGAGCTTAAAATGGGAGGG - Intergenic
1103974226 12:124691727-124691749 TTTAAAAGGTGAAAGTGGGTGGG - Intergenic
1105465748 13:20638008-20638030 TTTCAGGGCTTCAAGTGGGAGGG + Intronic
1107991153 13:45820166-45820188 TTTCAACCCTGAATTTAGGAGGG + Intronic
1108010311 13:46000506-46000528 TTTCGAGGCTGAAAGAGGTAAGG - Intronic
1109495725 13:63169141-63169163 TTTCAACACAGAAATTTGGAAGG + Intergenic
1110559929 13:76899790-76899812 TTTGATCCCTGAAATTGGGAGGG - Intergenic
1111541898 13:89679627-89679649 TTTAAAAGCAGAAAGAGGGAAGG + Intergenic
1114807177 14:25851321-25851343 TTTCAACTCTGAGTGTGTGATGG - Intergenic
1115023696 14:28714716-28714738 GTCCAATGCTGAGAGTGGGATGG - Intergenic
1115661402 14:35498280-35498302 TTCCAATGCTGAAAGTTGGGGGG - Intergenic
1117362189 14:54986860-54986882 TTTCAACGCTGAAAGTTCTCTGG + Intronic
1117840273 14:59853597-59853619 TTTCAACCCTTAAGATGGGAAGG - Intronic
1118151952 14:63199186-63199208 TTTCTACTCTGGAAGTGGAAAGG - Intergenic
1119816440 14:77572838-77572860 TATCAAGGCTGAAAGAGGTAAGG - Intronic
1122080069 14:99260993-99261015 TTTCAACGCTGAAAGTGGGAGGG - Intronic
1124002749 15:25772380-25772402 TTTTAAAGCTAAAAGTGGGCAGG - Intronic
1125024210 15:35014092-35014114 TTTCGATGCTGAAAGAGGGAGGG + Intergenic
1126249477 15:46551015-46551037 TTACAAAGCTCAAAGAGGGATGG - Intergenic
1126423563 15:48501378-48501400 CTTCACAGCTGAAAGTGGAAGGG - Intronic
1128025809 15:64435774-64435796 TTGCATGGCTGGAAGTGGGATGG + Intronic
1128728834 15:70007025-70007047 TTTCAACAGTGGAATTGGGAGGG + Intergenic
1137765614 16:50975479-50975501 TTTCAAGGCTAAAATTGGGCTGG + Intergenic
1144518865 17:15941123-15941145 TTTCACTGGTGAAAGTGGAAGGG - Intergenic
1146659343 17:34653886-34653908 TTCCTTGGCTGAAAGTGGGATGG - Intergenic
1147642649 17:42013729-42013751 TTCCAGTGCTGAAAATGGGATGG - Intronic
1149057534 17:52383620-52383642 TTTCTCCTCTGAAAGTGAGATGG - Intergenic
1150998721 17:70349452-70349474 TTTCAAAGGTCAGAGTGGGAGGG - Intergenic
1151081702 17:71336666-71336688 TTTTAATGCAGGAAGTGGGAAGG - Intergenic
1157949392 18:52017630-52017652 TTTCAACTCTGGAAATGGGCAGG + Intergenic
1159728842 18:71999256-71999278 ATTCAAGGCAGAAAGTGGAATGG - Intergenic
1159876654 18:73819462-73819484 TTTCAACAGTGAAACAGGGAAGG - Intergenic
1160057389 18:75496336-75496358 TTTCAACCATGACTGTGGGAGGG + Intergenic
1165324565 19:35106721-35106743 TTTCAAGGTGGAAATTGGGAAGG + Intergenic
925699587 2:6622068-6622090 TTTCATCCCTGATAGTGGTAAGG + Intergenic
927596363 2:24401523-24401545 TTACTTGGCTGAAAGTGGGAAGG + Intergenic
928025998 2:27739039-27739061 TTACAAGGGTCAAAGTGGGATGG - Intergenic
928625234 2:33133143-33133165 TTCCAACCCTGAAATTGGAATGG + Intronic
929388995 2:41446318-41446340 TTTAAATGATGAAAGTGGTATGG + Intergenic
929926289 2:46214218-46214240 GTTCAGTGCTGAAAGTGGGGTGG + Intergenic
933834806 2:86237060-86237082 TTTCATCTCTGAAATTGGGGTGG + Intronic
934476911 2:94599699-94599721 TTTATACGCTGAGAGAGGGACGG - Intronic
938859506 2:135352577-135352599 TTTCAAGGTTGAAAGTGAAAAGG + Intronic
940786108 2:157982420-157982442 GTTCAGTGCTGAAAGTGGGGTGG + Intronic
942001607 2:171653373-171653395 AGTCCACACTGAAAGTGGGAAGG + Intergenic
945588098 2:211692566-211692588 TTTAAAAGCTGAAAGAGGCAAGG - Intronic
946212708 2:218160459-218160481 TTTCTACCCTGAAGGTTGGAAGG + Intergenic
946397787 2:219451884-219451906 GCTCAAGGCTGAGAGTGGGAAGG - Intronic
946960469 2:224979644-224979666 TTTCCCTGCTGAAAGTGGCATGG + Intronic
947326826 2:228988311-228988333 TTTCAAGGATGAAAATGGAATGG - Intronic
947947294 2:234116336-234116358 TTTCAACTCTTCAACTGGGAAGG + Intergenic
1169471243 20:5887474-5887496 ATTGAAGGCTGAAACTGGGAGGG + Intergenic
1175475411 20:59269849-59269871 TTTCTACCCTGAAAGTCAGAGGG + Intergenic
1176982453 21:15398703-15398725 TTTCAACACTGAATTTTGGAAGG + Intergenic
1177781309 21:25625336-25625358 TTTAAATGCAGAAAGAGGGAAGG + Intergenic
1182747724 22:32618355-32618377 TTTCCAAGCTGAAAGTGGATGGG + Intronic
950259487 3:11534026-11534048 TTCCAACTCTGACAGTGGCACGG - Intronic
951421006 3:22484663-22484685 TTGCAATGCTGAAAATGAGAGGG - Intergenic
952512575 3:34071966-34071988 TTCCACCGCTGTCAGTGGGAGGG + Intergenic
955281108 3:57596019-57596041 TTTCAACGTTCAAAGTTAGAGGG + Intronic
957335840 3:78828118-78828140 TTTCAGTGTGGAAAGTGGGAAGG + Intronic
957704847 3:83767464-83767486 TTTCAAAGCTGCATGTGTGATGG + Intergenic
959551849 3:107668981-107669003 TTTAACCTCTGAATGTGGGAGGG - Intronic
960657874 3:120025961-120025983 TTTCAGCTCTGAAAGTATGATGG + Intronic
961044373 3:123698724-123698746 TCTCAGCGCTGAAAGAGTGAAGG - Intronic
962167595 3:133065801-133065823 TTTCAAGGCTTAAAATGGGTGGG + Intronic
964035333 3:152188801-152188823 TATCAAGGCTGAAAGAGGTAAGG + Intergenic
964398149 3:156269573-156269595 GTCCAATGCTGAAAGTGGGGTGG + Intronic
968327801 3:197835547-197835569 TTTCTATTTTGAAAGTGGGAGGG - Intronic
973579556 4:52328974-52328996 GTTCATTGCTGAAAGTGGGATGG + Intergenic
975012965 4:69378475-69378497 TTTCAAATCTGAGAGTGAGAAGG - Intronic
979539239 4:121861626-121861648 TTGCAAGGCTGGAACTGGGAGGG - Exonic
980195416 4:129582345-129582367 TTTAAAAACTGAAAGTTGGAAGG - Intergenic
984395853 4:179199165-179199187 TTTCAAAGCTGAAATTGGGATGG - Intergenic
992736248 5:79724507-79724529 GCTCAACGCTGAAAGTGTGGAGG + Intronic
993289826 5:86052856-86052878 TTCTACTGCTGAAAGTGGGAAGG + Intergenic
994080062 5:95698595-95698617 CTTCAAAGCTGCAAGAGGGAAGG - Intronic
994999977 5:107115417-107115439 TTTTAAATCTGAGAGTGGGAAGG - Intergenic
996661355 5:126007263-126007285 TTTCAACACAGAAAATGGCATGG - Intergenic
997192667 5:131952918-131952940 TATCAAGGCAGAAGGTGGGAAGG - Exonic
999040842 5:148410099-148410121 TTTCAATGGAGGAAGTGGGAGGG + Intronic
1000367952 5:160508437-160508459 TTCCAACTCTGAAAATGAGATGG - Intergenic
1001150903 5:169226354-169226376 GTTCAATCCTGGAAGTGGGAAGG - Intronic
1001397494 5:171427809-171427831 TTCCAAGGCAGAAGGTGGGATGG - Intronic
1011172484 6:84521512-84521534 TTAAAAGGCTGAAAGAGGGAGGG + Intergenic
1012982601 6:105845971-105845993 TTTCAACTGTGCAGGTGGGATGG - Intergenic
1015267632 6:131304473-131304495 TTTCAAAGAAGAAAGAGGGAAGG + Intergenic
1021922492 7:25500025-25500047 TTTAAACGATGAAACTGGAAGGG - Intergenic
1029617000 7:101665344-101665366 TATCAACGCTGAGAGCAGGAAGG - Intergenic
1030989638 7:116284595-116284617 TTTCATCACTGAAAGAGTGAAGG - Intergenic
1031152733 7:118073510-118073532 TCTCAACGCTCAAATGGGGAAGG - Intergenic
1031206195 7:118760893-118760915 TTTCACCACTGAAAGTGTCATGG - Intergenic
1038884748 8:31650846-31650868 CTACAAAGCTGAAAGTGGAAAGG - Intronic
1039783907 8:40815592-40815614 TCTCCACGCAGAAGGTGGGATGG + Intronic
1040674744 8:49735056-49735078 TCTCAACACAGTAAGTGGGAGGG + Intergenic
1042595773 8:70446427-70446449 AATCAACGCTGAGAATGGGAGGG - Intergenic
1042805237 8:72764095-72764117 TTTCAGGGGTGAAAGTGGAAAGG + Intronic
1047081124 8:121461953-121461975 TTTCAAATCAGAAAGTGTGATGG - Intergenic
1047542694 8:125785575-125785597 TTGCAACACTGAAACAGGGAGGG - Intergenic
1047920435 8:129629384-129629406 TTTCAATGTTGAGTGTGGGAAGG - Intergenic
1053348945 9:37399121-37399143 TTTAATCTCTGAAACTGGGATGG - Intergenic
1055545614 9:77370067-77370089 TCTGGACGCTGAAAGTGTGAAGG - Intronic
1186596817 X:10990687-10990709 TTTCAGGGCTTGAAGTGGGAGGG - Intergenic
1186679817 X:11860786-11860808 TTTCATTGCTGAAAGTGAGGTGG + Intergenic
1187307873 X:18113514-18113536 TTTCAACTCTGTAAGTGTGAGGG + Intergenic
1189386404 X:40540281-40540303 TGTCAACCCTGGAAGTGGGCAGG - Intergenic
1190396681 X:49992226-49992248 TTTCCAAGCTGAAATTTGGAAGG - Intronic
1192157545 X:68757804-68757826 TTTCAAAGCTGAAAGTTTAATGG - Intergenic
1193185310 X:78504904-78504926 GTCCAATGCTGAAAGTGGGATGG - Intergenic
1199323371 X:146467959-146467981 GTTCCAAGCTGAAAGTGGAATGG - Intergenic
1199730441 X:150626982-150627004 TTTCAAGGCTGAGAGGGAGAAGG - Intronic