ID: 1122080070

View in Genome Browser
Species Human (GRCh38)
Location 14:99260994-99261016
Sequence CTTTCAACGCTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080070_1122080074 -1 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080070_1122080079 24 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080070_1122080080 25 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080070_1122080073 -2 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080070_1122080078 23 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080070 Original CRISPR CTTTCAACGCTGAAAGTGGG AGG (reversed) Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
904832116 1:33312004-33312026 CTGTCAAAGCTGTGAGTGGGAGG - Intronic
910603579 1:89057908-89057930 TTTTCAATGCTGAAACTAGGTGG + Intronic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
917284888 1:173413454-173413476 TTTTCAGCACTGAGAGTGGGAGG - Intergenic
920938682 1:210459933-210459955 CTTTCAAAGGTGTAACTGGGCGG + Intronic
1062894951 10:1096343-1096365 CCTTCAACACTGAACTTGGGGGG - Intronic
1068934571 10:62623120-62623142 CTTTCAACCCCGAAAGATGGTGG - Exonic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1071532539 10:86400856-86400878 CTTCCAACCCGAAAAGTGGGTGG - Intergenic
1075579361 10:123605224-123605246 CTTTCAAGGCTTAAAGTGTTTGG - Intergenic
1084439559 11:69164799-69164821 CTTTCAACACTAAAATGGGGAGG + Intergenic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1091073705 11:132593523-132593545 CTTTCAATGTTGAAAATGGATGG + Intronic
1103156982 12:118693971-118693993 CTTTAAGGGCTGAAAGTGTGTGG + Intergenic
1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG + Exonic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1113350081 13:109520613-109520635 CATGCAACCCTGAAAGTGAGGGG - Intergenic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1115925555 14:38429451-38429473 CTTTACACCCTGAAAGTGGGAGG - Intergenic
1120492024 14:85190277-85190299 TTTTCATCGCTGTCAGTGGGTGG - Intergenic
1121689555 14:95866638-95866660 CTTTCTACTCTGTAAGTGTGGGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG + Intergenic
1127216884 15:56832888-56832910 CTTTAAACCCTAAAAGTGGGAGG + Intronic
1127578901 15:60318826-60318848 CTTTCAACTCTAATGGTGGGAGG - Intergenic
1130174084 15:81549263-81549285 CTTTCAACACTGCTAGTGAGAGG + Intergenic
1134602927 16:15547641-15547663 CATTAAAAGCTGAAAGTGGCTGG - Intronic
1135875476 16:26196129-26196151 CTTTTAATGCTGGAGGTGGGGGG - Intergenic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1144518866 17:15941124-15941146 CTTTCACTGGTGAAAGTGGAAGG - Intergenic
1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG + Intergenic
1147482142 17:40776226-40776248 ATTTCAAGGCTGGGAGTGGGAGG - Intergenic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1160057388 18:75496335-75496357 CTTTCAACCATGACTGTGGGAGG + Intergenic
926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG + Intergenic
928265792 2:29810600-29810622 CAGTCAACGTTGAAACTGGGAGG - Intronic
936886961 2:117322049-117322071 CTATCAATGCTGAGAGTGAGAGG + Intergenic
937280598 2:120714876-120714898 CTTTCAACATTTAAAGTAGGTGG - Intergenic
941797290 2:169613683-169613705 CTTTGAAAGGTCAAAGTGGGAGG + Intronic
942353371 2:175078558-175078580 CTTTCAGTGCTAAAACTGGGCGG + Intronic
942876906 2:180811340-180811362 CTTTTAAGGCTGAGAGAGGGAGG + Intergenic
946733762 2:222733983-222734005 CTTTCATTGCTGAGAGGGGGTGG + Intergenic
1173299503 20:41789215-41789237 CTGTCAACAGGGAAAGTGGGGGG + Intergenic
1175217059 20:57396844-57396866 CTTTCTGCCCTGAACGTGGGTGG - Intronic
1176724366 21:10417898-10417920 CTTTCAGCCATGATAGTGGGAGG + Intergenic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG + Intronic
1179067459 21:38039366-38039388 ATTTCAACGCAGGAACTGGGGGG - Intronic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
1184326495 22:43791494-43791516 CCTTCAACGGTGAACGTTGGAGG - Intronic
951421007 3:22484664-22484686 CTTGCAATGCTGAAAATGAGAGG - Intergenic
952212337 3:31240870-31240892 CTTTCAAGGCTGAAAATGAAGGG + Intergenic
954117395 3:48474740-48474762 CTTTCAAAGCTGAAAGGAGGGGG - Intronic
959551850 3:107668982-107669004 CTTTAACCTCTGAATGTGGGAGG - Intronic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961760818 3:129166150-129166172 CTATGGAGGCTGAAAGTGGGAGG + Intergenic
962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG + Intronic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
970607629 4:17695407-17695429 CTTTGAGAGGTGAAAGTGGGAGG - Intronic
970855156 4:20642707-20642729 CTTTGGACGGTCAAAGTGGGAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977233276 4:94477528-94477550 CTTTAAACGTTGAAACTTGGAGG + Intronic
977314557 4:95429522-95429544 CATTTAACTTTGAAAGTGGGAGG - Intronic
978712722 4:111804769-111804791 CTTTCCTCTCTGAAAATGGGTGG - Intergenic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG + Intronic
987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG + Intronic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
990210630 5:53479488-53479510 CATTCTTCGCTGAAAGTTGGCGG - Intergenic
990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG + Intergenic
991256048 5:64616200-64616222 CTCTCAAGGCTGAAAGTGTTTGG + Intergenic
992229289 5:74647987-74648009 CTTTCAACTCTGAAAGACAGAGG + Intronic
992861543 5:80916015-80916037 CTTTTAAAGCTGAAAGTGATGGG - Intergenic
993784668 5:92114994-92115016 CTTTCAAGGGGGAAAGTGTGAGG - Intergenic
995245628 5:109932108-109932130 CTTTGTAAGCTCAAAGTGGGAGG - Intergenic
1002895150 6:1374757-1374779 CTTTCAAAGCTTAAATTTGGGGG - Intergenic
1004853019 6:19719819-19719841 CTTTGCACGCTGAAAGGGGGAGG - Intergenic
1005020512 6:21413637-21413659 CTTTCAACTCTGAAATTGCCTGG - Intergenic
1006687658 6:35850537-35850559 CTTTTAAAGCTGGAAGTGAGTGG - Intronic
1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG + Intergenic
1008601899 6:53104584-53104606 CTTTCAAAGCTGCAAGTGACAGG + Intergenic
1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG + Intronic
1014602026 6:123425075-123425097 ATTTCAAAGGTGAAAGTGAGAGG + Intronic
1016753534 6:147658674-147658696 CTTTCAAGTCAGAACGTGGGTGG + Intronic
1021616602 7:22508272-22508294 CTTGCAGGGCTGAGAGTGGGAGG - Intronic
1022926407 7:35059485-35059507 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1028375857 7:90146066-90146088 CTTGCAGGGCTGAGAGTGGGAGG + Intergenic
1029824410 7:103174170-103174192 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1031832672 7:126646481-126646503 GTTTCAATGCTGAGAGAGGGAGG - Intronic
1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG + Intronic
1040674743 8:49735055-49735077 CTCTCAACACAGTAAGTGGGAGG + Intergenic
1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG + Intergenic
1056097112 9:83266629-83266651 CTTTCAACAATGAAAGGAGGGGG + Intronic
1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG + Intronic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1187307872 X:18113513-18113535 GTTTCAACTCTGTAAGTGTGAGG + Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1195700026 X:107698024-107698046 CTTTCATAGGTCAAAGTGGGTGG - Intergenic
1199016310 X:142819914-142819936 CTTTCAGCGCTGTGAGGGGGGGG - Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic