ID: 1122080071

View in Genome Browser
Species Human (GRCh38)
Location 14:99260997-99261019
Sequence TAACTTTCAACGCTGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080071_1122080080 22 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080071_1122080079 21 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080071_1122080078 20 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080071_1122080074 -4 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080071_1122080073 -5 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080071 Original CRISPR TAACTTTCAACGCTGAAAGT GGG (reversed) Intronic
901362791 1:8717772-8717794 TCACTTTTAATGCTGAAAATGGG - Intronic
907993417 1:59605327-59605349 AGACTTTCAGCGCTGAAACTGGG + Intronic
909533480 1:76707403-76707425 TAATTTCCAATGCTGAAGGTGGG - Intergenic
911683879 1:100750506-100750528 CAACTATCAACGCTGAAAACAGG - Intergenic
917476900 1:175376566-175376588 TAACTTTTTACGCTCCAAGTTGG + Intronic
918819841 1:189238258-189238280 TAACTTTCAATGCTGACTGTAGG + Intergenic
918896464 1:190354265-190354287 TAATTATCAAAGCTGAAAATGGG + Intronic
920452413 1:206069556-206069578 AAACTTTCAATGCTAAAACTAGG - Intronic
1065064611 10:21948255-21948277 TAACATTCAAGACTGCAAGTTGG - Intronic
1065205235 10:23351017-23351039 TAACTTTCTACAGTTAAAGTGGG + Intergenic
1068823532 10:61407169-61407191 TTACATTCAACTCTGAAAGATGG + Exonic
1069174304 10:65271225-65271247 TAACTTCCAACACTGACACTGGG - Intergenic
1069683275 10:70300283-70300305 GAACTTTCAATGCTAAAACTGGG - Exonic
1070426601 10:76294579-76294601 TAACTTTCAAAGTATAAAGTTGG + Intronic
1075440170 10:122473991-122474013 TGACTTTCCAGGCTGAAATTAGG - Intronic
1080147096 11:28999421-28999443 TAACTTTCAAAGCTTAGAGCAGG - Intergenic
1090648071 11:128782301-128782323 TTACTTTCAAAGTTGAAAGTTGG + Intronic
1091523445 12:1271889-1271911 AATCTTACAAAGCTGAAAGTAGG + Intronic
1095174863 12:39079953-39079975 TAACTTTCAATATTGTAAGTTGG - Intergenic
1097281702 12:57848629-57848651 TAACTTTAAACACTGAATTTGGG + Intergenic
1099871868 12:88359653-88359675 GGACTTTCTACGCTAAAAGTGGG + Intergenic
1100294094 12:93244860-93244882 TCACTTTCAATGCTGAGGGTGGG + Intergenic
1107991151 13:45820162-45820184 TAAGTTTCAACCCTGAATTTAGG + Intronic
1108896264 13:55333185-55333207 TAATTTTCAGTGCTGGAAGTGGG + Intergenic
1109522261 13:63529494-63529516 GATCTGTCAATGCTGAAAGTGGG + Intergenic
1109686045 13:65820860-65820882 GAACTGTCAGTGCTGAAAGTGGG - Intergenic
1111150050 13:84241197-84241219 TAACCTCCAATGCTGGAAGTGGG + Intergenic
1114440840 14:22746284-22746306 TAACTTATATTGCTGAAAGTAGG - Intergenic
1116029678 14:39555790-39555812 TATCTTACAATCCTGAAAGTTGG + Intergenic
1117653044 14:57926349-57926371 TAAATTTCCTCGGTGAAAGTAGG - Intronic
1120434271 14:84460541-84460563 TAACTTTCAGTGCTAAAACTGGG - Intergenic
1121182849 14:91942456-91942478 TACTTTTCAACACTGAAGGTAGG + Intronic
1121892882 14:97613752-97613774 ATATTTTCAATGCTGAAAGTAGG + Intergenic
1122080071 14:99260997-99261019 TAACTTTCAACGCTGAAAGTGGG - Intronic
1122085984 14:99305180-99305202 TTACTTTCATGGCAGAAAGTGGG - Intergenic
1122749455 14:103921764-103921786 GGACCTTCAACGCTGAAACTAGG + Intronic
1124258518 15:28165370-28165392 TAACTTCCTTCTCTGAAAGTGGG - Intronic
1125029693 15:35063684-35063706 TATCTTTAAAAGCTGAAAGATGG - Intergenic
1129886988 15:79045364-79045386 TAACATTTAACCCAGAAAGTGGG - Intronic
1132753875 16:1472674-1472696 TACCTTTCAGCCCTTAAAGTTGG + Intronic
1146671330 17:34740173-34740195 TGACTTTTTACCCTGAAAGTGGG + Intergenic
1151099940 17:71545246-71545268 TAACTGTCCCCGCTGTAAGTAGG + Intergenic
1155314612 18:24558958-24558980 TACCTTTCAACACTGAAATTAGG + Intergenic
1160041285 18:75347878-75347900 TGACCTTCAACGTTGGAAGTGGG - Intergenic
1160866530 19:1258640-1258662 TAACTTTCAACACATAAAGGGGG - Exonic
1165872833 19:38985369-38985391 TAGCTTTCAACACAGAAATTTGG - Intergenic
931890499 2:66666197-66666219 TACCTTTCAAAGCTGAAGGAAGG + Intergenic
933338632 2:80993457-80993479 AAACTTTTAGTGCTGAAAGTAGG + Intergenic
933403147 2:81824241-81824263 TACATTTCAACTCTGAAAATGGG - Intergenic
934500173 2:94853889-94853911 TAAGTGTCAAGGCTTAAAGTAGG - Intergenic
941027825 2:160477854-160477876 TAATTTTCAATGGTGAAAGATGG - Intronic
941700992 2:168604540-168604562 TAATTCTCAATGCTGGAAGTGGG + Intronic
944371247 2:198985896-198985918 TAAATTTCAACCCCGAAAATGGG + Intergenic
944554880 2:200878226-200878248 TAAATTTTAACTCTGAAAGCTGG - Intronic
947469609 2:230388882-230388904 TAAATTTCAAGGCTGAAGATAGG + Intronic
1168902988 20:1380847-1380869 TAGTTTTCATCTCTGAAAGTTGG - Intronic
1170725264 20:18920509-18920531 TAATCCTCAATGCTGAAAGTGGG + Intergenic
1174690670 20:52501314-52501336 AAACTTTCGACACTGAAAATTGG - Intergenic
1184324533 22:43773275-43773297 CATCTTTCAACTCTGAAATTTGG + Intronic
950108374 3:10402780-10402802 TAAATTTCAACTCTGACAATAGG - Intronic
951335163 3:21412068-21412090 TAACTTTGAATGCTTATAGTTGG - Intergenic
953196977 3:40743621-40743643 TAACTTTCAACACTTAAAGAAGG - Intergenic
953511360 3:43543261-43543283 CAACTTTCAAATCTGAAACTAGG + Intronic
954285209 3:49614357-49614379 TAACTTTAAAGACTGAATGTCGG - Intronic
955569404 3:60288110-60288132 TCACTTACAAGGCTGGAAGTTGG + Intronic
956723075 3:72135402-72135424 GAACTTTCAGTGCTGAAAATTGG + Intergenic
957688360 3:83534264-83534286 TAATTTTCAACTCTAAAAGTTGG - Intergenic
959551851 3:107668985-107669007 TAACTTTAACCTCTGAATGTGGG - Intronic
963506646 3:146194262-146194284 TAACTTTGACAGCTGAGAGTGGG - Exonic
968235528 3:197028565-197028587 TTACTTTCAACACAGAAGGTGGG - Intronic
969085954 4:4656550-4656572 TAACCCTCAATGCTGAAGGTGGG - Intergenic
969553209 4:7886412-7886434 GCAGTTTCAACTCTGAAAGTGGG + Intronic
980195417 4:129582349-129582371 TAAATTTAAAAACTGAAAGTTGG - Intergenic
984520422 4:180795552-180795574 TAACCTTCACCTGTGAAAGTTGG + Intergenic
985800085 5:2000168-2000190 TAACTTTTTAGGCTGAAAATTGG - Intergenic
989071144 5:37512986-37513008 TAACTATCTACCCTGTAAGTGGG - Intronic
994715453 5:103316333-103316355 AAAATTTCCAGGCTGAAAGTAGG - Intergenic
995495283 5:112735616-112735638 TAATTTTCCATGCTGAAATTTGG + Intronic
1001423070 5:171601487-171601509 TGACTTTCATCTCTGAAAGTAGG + Intergenic
1003130786 6:3393729-3393751 TAACTTTCAACGTTTGAAGAGGG + Intronic
1004966411 6:20856741-20856763 GAACTTTAAAGGCTGCAAGTTGG + Intronic
1008271858 6:49499558-49499580 AAACTTCCAAGGCTGAAAGGGGG - Intergenic
1008686049 6:53927433-53927455 TAACTTTAGACTCTGAGAGTGGG + Intergenic
1013765852 6:113573291-113573313 TAACTTTGAAAGTTGAAATTGGG - Intergenic
1014509745 6:122306726-122306748 TAACTTTCAAAGTTGGAGGTGGG + Intergenic
1018416799 6:163608607-163608629 TAACTTCCTAAGCTGAAATTCGG - Intergenic
1020364393 7:7365038-7365060 TGACTTCCAACTCTAAAAGTTGG + Intronic
1021011714 7:15476675-15476697 CAACTTTCAAAGCTGATAGAAGG - Intronic
1022080575 7:27016280-27016302 GATCTATCAATGCTGAAAGTGGG - Intergenic
1023569506 7:41557435-41557457 GAACTTTCAGAGCTGAAAGAAGG + Intergenic
1024863875 7:53880589-53880611 CAACTTTCTCTGCTGAAAGTAGG - Intergenic
1030990615 7:116294866-116294888 GATCTGTCAATGCTGAAAGTGGG - Intronic
1031532470 7:122892227-122892249 TAACTTTTAAGGGTGAAAATGGG - Intergenic
1031934252 7:127719639-127719661 TAACTTACAACCCTGAAAACAGG - Intronic
1033438577 7:141357149-141357171 TAACTTTTAAGGCTGACATTAGG - Intronic
1035852079 8:2930570-2930592 CAACTTTCCAAGCTGCAAGTTGG - Intergenic
1036829063 8:12007013-12007035 GAATGTTCAATGCTGAAAGTGGG - Intergenic
1036834295 8:12046971-12046993 GAATGTTCAATGCTGAAAGTGGG - Intergenic
1036856140 8:12293536-12293558 GAATGTTCAATGCTGAAAGTGGG - Intergenic
1037669587 8:21002635-21002657 AGACTTTCAAAGCTAAAAGTTGG + Intergenic
1043180829 8:77084771-77084793 GAAATTTCAAAGCTGAAAGGAGG - Intergenic
1043342439 8:79256367-79256389 TAACTTACAGCTCTGAAGGTTGG - Intergenic
1046273586 8:111927463-111927485 TAGGTTTCTAGGCTGAAAGTGGG - Intergenic
1051704601 9:19863308-19863330 GATCTGTCAATGCTGAAAGTGGG - Intergenic
1053656995 9:40226653-40226675 TAAGTGTCAAGGCTTAAAGTAGG + Intronic
1053907363 9:42855940-42855962 TAAGTGTCAAGGCTTAAAGTAGG + Intergenic
1054369114 9:64372929-64372951 TAAGTGTCAAGGCTTAAAGTAGG + Intronic
1054527602 9:66149575-66149597 TAAGTGTCAAGGCTTAAAGTAGG - Intronic
1054676744 9:67862683-67862705 TAAGTGTCAAGGCTTAAAGTAGG + Intronic
1056386448 9:86100401-86100423 TCACTTTGAACTCTGGAAGTGGG - Intergenic
1057535858 9:95905576-95905598 TAACTTTCAAATATGAAATTAGG - Intronic
1059033795 9:110731473-110731495 TAACTTTCAATACTGAAAAAAGG + Intronic
1060464264 9:123888461-123888483 TAACTTTCAATGCAGAAGTTTGG + Intronic
1188668505 X:32854115-32854137 TGACGTCCAAGGCTGAAAGTGGG - Intronic
1190526880 X:51337092-51337114 TAACTTGCAAGGATGAAAGATGG + Exonic
1192449540 X:71235293-71235315 GAACTTTCATTGCTGAAACTGGG + Intergenic
1194120016 X:89950274-89950296 TAACCTTCAATGTTGAAGGTGGG - Intergenic
1194201934 X:90962574-90962596 TAACTTTCGAATCTGTAAGTTGG - Intergenic
1197553896 X:127931345-127931367 TTAATTTTAAAGCTGAAAGTTGG - Intergenic
1199842686 X:151666282-151666304 TATCTTTCAAGGCTGGAAGTCGG - Intronic
1200472879 Y:3607791-3607813 TAACCTTCAATGTTGAAGGTGGG - Intergenic
1200547771 Y:4538026-4538048 TAACTTTCGAATCTGTAAGTTGG - Intergenic