ID: 1122080072

View in Genome Browser
Species Human (GRCh38)
Location 14:99260998-99261020
Sequence TTAACTTTCAACGCTGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080072_1122080080 21 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080072_1122080079 20 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080072_1122080078 19 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080072_1122080074 -5 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080074 14:99261016-99261038 GTTAAACCCCTGAGATGACAGGG 0: 1
1: 0
2: 1
3: 14
4: 119
1122080072_1122080073 -6 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080072 Original CRISPR TTAACTTTCAACGCTGAAAG TGG (reversed) Intronic
906904442 1:49874472-49874494 TTATCTTTCAATGCTTAAAAGGG + Intronic
908188371 1:61674663-61674685 TAAGCTTTCAACACTTAAAGAGG + Intergenic
908531858 1:65041319-65041341 TTCATTTTCAAAGCTGAAAGGGG + Intergenic
910300136 1:85696726-85696748 TTAACTATCAACAATGGAAGAGG + Intronic
915187743 1:154121574-154121596 GAAACTTTAAAGGCTGAAAGCGG + Intronic
918896463 1:190354264-190354286 TTAATTATCAAAGCTGAAAATGG + Intronic
919110484 1:193213075-193213097 TTAAATTTTAAATCTGAAAGTGG - Intronic
919395494 1:197042366-197042388 TTAACTTTCAGCTATGACAGAGG + Intronic
919466953 1:197932625-197932647 TTAATTTTGAACACTTAAAGAGG + Exonic
920079499 1:203362052-203362074 TTGAATTGCAAAGCTGAAAGAGG - Intergenic
924106144 1:240651180-240651202 TTAACTTTCTAGAGTGAAAGTGG + Intergenic
924549175 1:245058451-245058473 TTAAATTTCTTCACTGAAAGAGG - Intronic
924849645 1:247812949-247812971 TTCACTTTTTACTCTGAAAGAGG + Intergenic
1064868519 10:19910228-19910250 TTAATTTCCAAAGATGAAAGAGG - Intronic
1065205234 10:23351016-23351038 TTAACTTTCTACAGTTAAAGTGG + Intergenic
1066335188 10:34469602-34469624 TGAACTTTTAAGGATGAAAGTGG - Intronic
1068503788 10:57873245-57873267 TTAGCTTTCAAAGCTGAATTTGG - Intergenic
1074991790 10:118715328-118715350 TTAACTTTCAAAGCTAAACAAGG + Intronic
1079497916 11:21067183-21067205 TTTGCTTTCAAATCTGAAAGGGG + Intronic
1092642679 12:10533420-10533442 TAATCTTTCCATGCTGAAAGTGG - Intergenic
1094488851 12:30946082-30946104 TGAACTTTCAGAACTGAAAGGGG + Intronic
1100061132 12:90576553-90576575 TTAACTTCCTACACTGAAAGAGG - Intergenic
1100102973 12:91132099-91132121 TAAACTTTCAACACAGAAAATGG + Intergenic
1100294093 12:93244859-93244881 TTCACTTTCAATGCTGAGGGTGG + Intergenic
1104087540 12:125490427-125490449 TTAAGTTTCACCTCTTAAAGGGG - Intronic
1105860850 13:24411177-24411199 TTAACTGTGAAAGCTGAAATAGG - Intergenic
1109211386 13:59539086-59539108 TTAACTTTTCATGCTGAAAGAGG - Intergenic
1109686046 13:65820861-65820883 TGAACTGTCAGTGCTGAAAGTGG - Intergenic
1112659088 13:101486671-101486693 TGAAGTTTCAAAGCTGCAAGAGG - Intronic
1114788158 14:25624982-25625004 TTAAGTTTCATAGCTGAAACAGG + Intergenic
1120931247 14:89850761-89850783 TTAACTTTCACCTCTAAAAAGGG + Intronic
1122080072 14:99260998-99261020 TTAACTTTCAACGCTGAAAGTGG - Intronic
1124616286 15:31244722-31244744 TGAACTTTCAAGGCTGACTGTGG - Intergenic
1128796102 15:70467862-70467884 TTAACTTTGCACCCTGTAAGAGG + Intergenic
1134602928 16:15547645-15547667 TAAACATTAAAAGCTGAAAGTGG - Intronic
1138744418 16:59347037-59347059 TTAACTCTCCATACTGAAAGGGG + Intergenic
1139216790 16:65133409-65133431 TTATCTTTCATCTCTCAAAGTGG + Intergenic
1139658754 16:68405703-68405725 TTAACTTACATTTCTGAAAGAGG - Intronic
1139810260 16:69609213-69609235 TTAACTAGCAATGCTTAAAGAGG + Intronic
1142649958 17:1342439-1342461 TGAACTTCCATCACTGAAAGGGG - Intergenic
1153185060 18:2477097-2477119 TTATCCTTCAAAACTGAAAGAGG - Intergenic
1156916510 18:42468791-42468813 TTGACTTTCACTGCTGAAAAAGG + Intergenic
1157130509 18:45002904-45002926 TTAACTATCAATCCTCAAAGAGG - Intronic
1157445869 18:47746730-47746752 TGAACTTTCAAGGTTGGAAGAGG - Intergenic
1157638540 18:49187574-49187596 TTAAAATTCAAAGCTGAAATAGG + Intronic
1159305648 18:66638801-66638823 TTAACATCCAACCCTGGAAGTGG + Intergenic
1160041286 18:75347879-75347901 TTGACCTTCAACGTTGGAAGTGG - Intergenic
1160866531 19:1258641-1258663 TTAACTTTCAACACATAAAGGGG - Exonic
1162014343 19:7836363-7836385 TTATTTTTCAACGGTGAGAGAGG - Intronic
928296391 2:30087680-30087702 TTATCTCTAAATGCTGAAAGTGG - Intergenic
929663771 2:43817086-43817108 TTAATTTTCAGCGATGGAAGTGG + Intronic
930004226 2:46883072-46883094 TCAACTTCCAAAGCTGACAGTGG - Intergenic
930422657 2:51174042-51174064 TTAATTTTCATTGATGAAAGAGG - Intergenic
932125250 2:69139427-69139449 TCAACTTCTAACCCTGAAAGAGG - Intronic
935187018 2:100743796-100743818 ATAACTTTCCACTCTGAATGGGG - Intergenic
935818244 2:106867912-106867934 TTAACTTACAACCCAGACAGTGG - Intronic
935921193 2:108017422-108017444 TTAAATTTCAAGACAGAAAGAGG - Intergenic
942365774 2:175225401-175225423 TTATCTTTCAAGAATGAAAGTGG - Intergenic
944078457 2:195758612-195758634 TTAACTTTAATCACTGAAAGAGG + Intronic
944371246 2:198985895-198985917 TTAAATTTCAACCCCGAAAATGG + Intergenic
946719788 2:222592346-222592368 TAAACTGTCAACGCTCTAAGTGG - Intronic
1174103180 20:48142803-48142825 TCTACTCTGAACGCTGAAAGGGG + Intergenic
950968280 3:17161651-17161673 TTAACTTTCATCTGTGAAACAGG + Intronic
951305716 3:21058961-21058983 TTAACTTTCAAAGCGGTAAGTGG - Intergenic
951507142 3:23459869-23459891 TTAGTTTTAAATGCTGAAAGGGG + Intronic
951914422 3:27784880-27784902 TTAACTTTTAATTGTGAAAGGGG - Intergenic
952553797 3:34508792-34508814 TTAAATTTGAACTCAGAAAGAGG + Intergenic
954029008 3:47804613-47804635 TTATCTTCAAAGGCTGAAAGGGG - Intronic
955113144 3:55969620-55969642 TTAACACTCAACCCTGAAAGGGG - Intronic
957119803 3:76075239-76075261 GTAACTTCCAAGGCTGAGAGTGG + Intronic
959551852 3:107668986-107669008 TTAACTTTAACCTCTGAATGTGG - Intronic
963506647 3:146194263-146194285 TTAACTTTGACAGCTGAGAGTGG - Exonic
963954119 3:151234269-151234291 GTAACTTTCAAAGCTTCAAGTGG + Intronic
968235529 3:197028566-197028588 TTTACTTTCAACACAGAAGGTGG - Intronic
968326860 3:197825118-197825140 TCAATTTTAAACACTGAAAGTGG - Intronic
969553208 4:7886411-7886433 TGCAGTTTCAACTCTGAAAGTGG + Intronic
972272345 4:37523415-37523437 TTAACTTCCATTGCTGAAAGAGG - Intronic
973338986 4:48985728-48985750 TTTACTATCAAAGCTGAGAGTGG + Intergenic
975502396 4:75100885-75100907 TAACTTTTTAACGCTGAAAGAGG - Intergenic
989392708 5:40918864-40918886 TTATCTTTCATTGTTGAAAGTGG - Intronic
989988188 5:50727855-50727877 GTAATTTTCAACTCTGAAGGCGG - Intronic
991960072 5:72035552-72035574 TTACCTTTCAAGGCTGAAGCAGG - Intergenic
992218700 5:74550349-74550371 TTAACTTTCAAATCTGACAGAGG + Intergenic
992260297 5:74963462-74963484 TTATCTTTCCAGGCAGAAAGAGG - Intergenic
994245772 5:97474074-97474096 TTATTTTTCTACACTGAAAGAGG + Intergenic
1001277621 5:170362017-170362039 TTAAATTCCAAAGCTGAAAGAGG - Intronic
1003130785 6:3393728-3393750 ATAACTTTCAACGTTTGAAGAGG + Intronic
1003303287 6:4904115-4904137 TGAACTTTCAACACTGCGAGGGG - Intronic
1008271859 6:49499559-49499581 TAAACTTCCAAGGCTGAAAGGGG - Intergenic
1012981272 6:105832436-105832458 TTAACTTTCACCGCTGAGTAGGG + Intergenic
1013153757 6:107473251-107473273 TTAGCTTTCATAGCTGTAAGAGG - Intergenic
1013765853 6:113573292-113573314 TTAACTTTGAAAGTTGAAATTGG - Intergenic
1013821272 6:114155995-114156017 TTAATTTTCAACAGTGAAACAGG + Intronic
1017622614 6:156314761-156314783 TTAACCTTCAACGCCAAATGAGG - Intergenic
1018538092 6:164845290-164845312 CTAAATTTCAACCCTGAAGGTGG - Intergenic
1021974982 7:26003135-26003157 TTTGCTTTCAACGCTAGAAGAGG - Intergenic
1022230979 7:28411418-28411440 TTAAGTTTCTATGTTGAAAGAGG + Intronic
1027549812 7:79576496-79576518 TATACTTTCAAGGATGAAAGAGG + Intergenic
1027675891 7:81158151-81158173 TTTATTTTCAACCCTGAAAAAGG + Intergenic
1028225290 7:88244012-88244034 TAAACTTTCAAAGCAGAAACAGG + Intergenic
1028838321 7:95398569-95398591 TTAACTTTAAACCCTAGAAGTGG + Intergenic
1030322107 7:108179904-108179926 TTAACTTTCTGACCTGAAAGAGG - Intronic
1030990616 7:116294867-116294889 TGATCTGTCAATGCTGAAAGTGG - Intronic
1035403220 7:158581740-158581762 TTAACTCTCATCTCTGGAAGTGG - Intronic
1036829064 8:12007014-12007036 TGAATGTTCAATGCTGAAAGTGG - Intergenic
1036834296 8:12046972-12046994 TGAATGTTCAATGCTGAAAGTGG - Intergenic
1036856141 8:12293537-12293559 TGAATGTTCAATGCTGAAAGTGG - Intergenic
1038513580 8:28163576-28163598 TTATCTTTCATCGCACAAAGAGG + Intronic
1042873805 8:73422257-73422279 AAAACTTTCACCGCTGAAAATGG + Intronic
1046175992 8:110575545-110575567 TTGACTTTCAATTTTGAAAGTGG - Intergenic
1046360593 8:113149157-113149179 TTAAATTTAAACTCTTAAAGGGG + Intronic
1046905608 8:119569226-119569248 TTAACTTACAAGGAGGAAAGAGG + Exonic
1048185172 8:132233824-132233846 TTAACTTTAAATTCTGAAGGTGG + Intronic
1050122118 9:2318068-2318090 TTAACTTGTATCACTGAAAGAGG - Intergenic
1050974096 9:11914604-11914626 TTACCTTTCAACGTTGGATGAGG - Intergenic
1053438175 9:38091493-38091515 TTAATTTCCAAAGCAGAAAGAGG - Intergenic
1054851805 9:69854189-69854211 TTAAGTTACAACCCTGTAAGTGG - Intronic
1056386449 9:86100402-86100424 TTCACTTTGAACTCTGGAAGTGG - Intergenic
1058424654 9:104865886-104865908 GGAACTTTCAAGGCTGAAAGGGG + Intronic
1188215899 X:27476717-27476739 GTAACTCTCAAGGCTAAAAGGGG + Intergenic
1192091522 X:68162708-68162730 TGAAATTTCAAAGCTGAAAAGGG + Intronic
1192449539 X:71235292-71235314 TGAACTTTCATTGCTGAAACTGG + Intergenic
1195014800 X:100767270-100767292 TTAACTTCCTTTGCTGAAAGAGG - Intergenic
1198388915 X:136154012-136154034 TCAAGTTTCAATGCTAAAAGAGG + Intronic
1198977834 X:142357263-142357285 TTAACTAGCAATGCTGACAGTGG - Intergenic