ID: 1122080073

View in Genome Browser
Species Human (GRCh38)
Location 14:99261015-99261037
Sequence AGTTAAACCCCTGAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080069_1122080073 -1 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080068_1122080073 0 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080070_1122080073 -2 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080071_1122080073 -5 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080067_1122080073 4 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122
1122080072_1122080073 -6 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG 0: 1
1: 0
2: 1
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080073 Original CRISPR AGTTAAACCCCTGAGATGAC AGG Intronic
904117807 1:28175339-28175361 AGTTCAGCCCCTTAGATGACTGG - Intronic
907297909 1:53467213-53467235 AGTAAAACCCCTTAGAGGAGGGG - Exonic
908566840 1:65365694-65365716 ATTTATACCCCTGAGGTCACGGG + Intronic
910633214 1:89378674-89378696 AATGAAACCCCAGAGATGATGGG - Intronic
919045157 1:192442028-192442050 AGTTTGTCCACTGAGATGACTGG - Intergenic
919048225 1:192480642-192480664 GCTTAAACCCCTGACAAGACGGG - Intergenic
921557583 1:216616940-216616962 AGAAAAAACCCTGAGGTGACAGG - Intronic
923148054 1:231211417-231211439 AGTTGGACCCCAGAGCTGACTGG + Intronic
924686440 1:246295824-246295846 CGTTAAACAATTGAGATGACAGG + Intronic
1063580802 10:7304913-7304935 AGTTGCACCCCTGGGAGGACAGG + Intronic
1063754218 10:8987737-8987759 AGGTAAATTCCTGAGAAGACTGG - Intergenic
1064031065 10:11883187-11883209 TGTTAAGCCGCTGAGATCACAGG - Intergenic
1065931372 10:30482094-30482116 AGTTCAACCCCTGACTTAACCGG + Intergenic
1066210663 10:33234314-33234336 ACTTATACCCCAGAGAAGACTGG + Intronic
1066657063 10:37705783-37705805 AGTTAAACCCCTGTGAGGCCTGG + Intergenic
1067763450 10:49068281-49068303 AGATAATCCCATGAGCTGACCGG + Intronic
1070296672 10:75167554-75167576 AGTTAAACACCTGTGATTCCAGG - Intronic
1071902146 10:90132143-90132165 AGAAAAACCCCTGTGAAGACAGG - Intergenic
1072410084 10:95193853-95193875 CTTTAACCCACTGAGATGACAGG - Intergenic
1074683438 10:115934261-115934283 TGTTAAACCCTTGAGATTTCAGG + Intronic
1076728717 10:132426844-132426866 AGATAAAGCCCTGGGATGGCTGG + Intergenic
1077855932 11:6124764-6124786 AGTTAGATCCCTGAGATACCTGG - Intergenic
1080873224 11:36255186-36255208 TGTTAAACCACTGAGATTTCTGG + Intergenic
1083707452 11:64526117-64526139 ATCTAAAACCCTGTGATGACTGG + Intergenic
1084523730 11:69683137-69683159 GGTTAAGCCACTGAGATGTCAGG - Intergenic
1085491175 11:76919204-76919226 ACATAAAACCCTGAGGTGACTGG - Intronic
1086613300 11:88783166-88783188 AGTTAAACCCCTAAGATTATGGG - Intronic
1088138171 11:106582472-106582494 AGTGAAACCACTGAGACTACAGG + Intergenic
1089249163 11:117144857-117144879 AGTTAGACCCCTGTGATAAAGGG - Intronic
1093359585 12:18206885-18206907 AATAAAACCCCTGAGATAGCAGG - Intronic
1098138790 12:67430496-67430518 ACTTAACCCCCTGAGCTCACTGG - Intergenic
1099405941 12:82262602-82262624 AGTTCAACCCATGAGAAGGCAGG - Intronic
1103422490 12:120798861-120798883 GGTTAAACCAAAGAGATGACTGG - Intronic
1105837216 13:24222571-24222593 AGGTAAACTCCTGAGCTCACTGG - Intronic
1107810876 13:44198758-44198780 AGGCAAATCCCTGAGATGGCTGG - Intergenic
1108382868 13:49871041-49871063 ATTTGAACCCCTGAGGGGACCGG - Intergenic
1112941974 13:104874688-104874710 AGTTCTTCCCCAGAGATGACTGG + Intergenic
1115531353 14:34331005-34331027 ACTTTAACCCCTGTCATGACTGG + Intronic
1120817354 14:88876174-88876196 AGTTAAACCCCCAAGAGGGCTGG + Intronic
1121237506 14:92403305-92403327 ACTTAAAGCTCTGAGAGGACTGG + Intronic
1122080073 14:99261015-99261037 AGTTAAACCCCTGAGATGACAGG + Intronic
1122101467 14:99413651-99413673 AGCTAATCCCCTGCCATGACAGG + Intronic
1126684325 15:51234297-51234319 AGTGAAAAGCCTGAGAGGACAGG + Intronic
1127221953 15:56889166-56889188 ATTGAAGGCCCTGAGATGACTGG - Intronic
1128441021 15:67708641-67708663 TTTTAAACCCCTGAAGTGACAGG + Intronic
1129435772 15:75539126-75539148 GGTGAAACACCTGAGATTACAGG - Intronic
1133479641 16:6157435-6157457 AGATAAACAACTGAAATGACTGG - Intronic
1133968494 16:10549158-10549180 TGTTAAACCACTGAGATTTCAGG + Intronic
1135993774 16:27233233-27233255 AGTAAAACCACTCAGATCACAGG + Intronic
1136345934 16:29676026-29676048 AGTTATACCGCTGAGATGTGGGG - Intronic
1137799339 16:51248015-51248037 AGTTGAACCCCTGAGAATAAAGG - Intergenic
1138453689 16:57108528-57108550 GGTTCAACCACTGGGATGACAGG + Intronic
1139242272 16:65405093-65405115 ATTCAGACCCCTGAGAAGACAGG + Intergenic
1141527752 16:84623272-84623294 ACTTTAAGCCCTGAGAGGACTGG - Intergenic
1144054236 17:11524942-11524964 AGTTGAAACCCTGAGATGACGGG + Intronic
1146552891 17:33797306-33797328 AGACAAACCTCTGAGATGTCAGG + Intronic
1146707472 17:35011793-35011815 AGGTACACCCCTGGGAAGACAGG + Exonic
1156827070 18:41443798-41443820 AGTTAAATACCTGAGATGTGTGG + Intergenic
1159595531 18:70379478-70379500 CGCTAAACCCCTGAAATGCCAGG - Intergenic
1161243363 19:3235240-3235262 TGTGAAACCCCTGTGATGGCAGG + Intronic
1164500194 19:28813057-28813079 TCTTGAACCCCTGAGATAACAGG - Intergenic
1166188937 19:41162308-41162330 AGTTAAAAGTCTGGGATGACTGG + Intergenic
926394487 2:12427250-12427272 ATTTAAACCCCTCTGATGCCAGG + Intergenic
927512185 2:23650724-23650746 CATTAAACCCCTGTCATGACAGG - Intronic
930218000 2:48716728-48716750 AATTCAACCCCTAAAATGACAGG - Intronic
932190254 2:69735360-69735382 AGTTAAAGTCCAGAGGTGACTGG - Intronic
937994219 2:127680808-127680830 AGCCAAACCCATGAGATGAATGG - Intronic
941753772 2:169162956-169162978 TGTTACACCCCTGAGATTTCAGG + Intronic
943137330 2:183930157-183930179 AGTTCACCACCTGAGAGGACAGG + Intergenic
945156199 2:206841256-206841278 TGCTAAACCTCTGAGATGTCAGG + Intergenic
948872655 2:240811521-240811543 AGCTGAACCCCTGAGAAGGCGGG + Intronic
1174033695 20:47652061-47652083 AGTTATAATCCTCAGATGACAGG - Intronic
1176458120 21:6930393-6930415 TGTTAAGCCACTGAGATGTCAGG - Intergenic
1176836294 21:13795488-13795510 TGTTAAGCCACTGAGATGTCAGG - Intergenic
1182760821 22:32721127-32721149 ATTTACACCCTTGAGAAGACAGG + Intronic
949318707 3:2785668-2785690 AGGAAAACCCCTCAGATGGCAGG + Intronic
952132015 3:30374859-30374881 AGATAGACCTCTGGGATGACTGG + Intergenic
953282775 3:41574996-41575018 ATTTAAACCCCTGAAAGGAGGGG + Intronic
954645936 3:52131573-52131595 AGTCAGGCCCTTGAGATGACTGG + Intronic
954928671 3:54260744-54260766 AGTCAAACTCCTGAGCTGAAAGG - Intronic
956051432 3:65252415-65252437 TGTTAAACCACTGAGATCTCAGG + Intergenic
960740781 3:120831114-120831136 AGTTAGAGCCCTGAGATGTTTGG - Intergenic
967046816 3:185745131-185745153 AGTTAAACCCGTGTGATCAGAGG - Intronic
974737281 4:65952901-65952923 ATTTAGACGCCTGACATGACAGG - Intergenic
980097091 4:128502230-128502252 ACTCAAACCCCTTACATGACGGG - Intergenic
981702896 4:147626584-147626606 ATTTACACCCTTGAAATGACAGG + Intronic
983225589 4:165083058-165083080 AGTTAACCCCATGAGGTGAAGGG + Intronic
984724656 4:183009323-183009345 AGATAGACCCCTGAGGTCACAGG + Intergenic
984731667 4:183074390-183074412 GGCTAAACCCTTGAGAAGACAGG + Intergenic
989896445 5:47092709-47092731 AGTTCAACCTGTGAGATGAGTGG + Intergenic
990778968 5:59336526-59336548 AGTTTGAACCCTGAGATGCCTGG - Intronic
991490359 5:67176929-67176951 AAGCAAACCACTGAGATGACAGG + Intergenic
995889251 5:116932434-116932456 GGTCAAAACCCTGAGATCACAGG - Intergenic
996309861 5:122092502-122092524 AGTAAAGCCCCTGACAAGACGGG - Intergenic
996982068 5:129510030-129510052 AGTAAATACCCTGAGATGTCTGG - Intronic
1001006712 5:168058233-168058255 AACAAAACCCCTGTGATGACAGG - Intronic
1001256481 5:170187346-170187368 AGTTCAACCCCTCACCTGACAGG + Intergenic
1002269801 5:178063460-178063482 AGTGAAACTGCTGAGATGAAAGG - Intergenic
1002352296 5:178591544-178591566 AGGGGAACCCCTGAGATGGCCGG + Intergenic
1202772123 5_GL000208v1_random:16067-16089 AGTTCAACCTGTGAGATGAGTGG + Intergenic
1002787892 6:418473-418495 AATTATACCCCTGAGATGTGGGG + Intergenic
1009792038 6:68416019-68416041 AGTTATACCACTGAGATACCTGG - Intergenic
1010984478 6:82407867-82407889 AGTTAAAACACTTAGAAGACAGG - Intergenic
1012403504 6:98866486-98866508 ATTTTAAACCCTGAGATTACAGG - Intergenic
1020396226 7:7721724-7721746 AGTAAAATCCCTGAGAGGGCAGG - Intronic
1020643060 7:10779846-10779868 ACTTCAACCCCTGGGAAGACTGG + Intergenic
1022502829 7:30893308-30893330 AGTTTTACCCCTGACATGCCTGG - Intergenic
1023169966 7:37381356-37381378 ATTTAAACCCCCTAGATTACTGG + Intronic
1027485602 7:78757832-78757854 GTTTAAAGCCCTGAGATGAATGG - Intronic
1028740036 7:94263519-94263541 AGTTTAACAACTGATATGACTGG + Intergenic
1029105063 7:98168120-98168142 AGTTAAACTCCTCAGAAGCCTGG - Intronic
1029901684 7:104047615-104047637 TGTTAAGCCCCTGAGATTTCAGG + Intergenic
1030993948 7:116335401-116335423 AGTTAAACTGATGAGATGCCTGG + Intronic
1031910399 7:127511035-127511057 AGTTAAAATCTTGAGATGACAGG + Intergenic
1036452337 8:8879926-8879948 AGTTTAACTCCTGGAATGACTGG - Intronic
1039400212 8:37262837-37262859 AGTTAAACATCCCAGATGACTGG - Intergenic
1039515375 8:38128297-38128319 AGTTAAAGATCTCAGATGACCGG + Exonic
1046359638 8:113132880-113132902 AGTAAAAACCCTGAGGTCACAGG - Intronic
1048588189 8:135795106-135795128 GGTTAAGCCTCTGAGATGTCGGG + Intergenic
1051411714 9:16796355-16796377 ACTTAAAGCCCTGTGCTGACAGG + Intronic
1053381957 9:37655955-37655977 AGTGAAATCCCTGGGATGAGGGG - Intronic
1055770527 9:79711981-79712003 AGTTGAACCACTGAGAAGAGTGG + Intronic
1059465555 9:114466886-114466908 AGGCAGACCCCTGAGGTGACGGG - Intronic
1187812481 X:23194553-23194575 AGTTATACCTCTGAGATGCAAGG - Intergenic
1190650790 X:52566611-52566633 AGTAAAGCCCCTGAGAAGAGGGG + Intergenic
1195021008 X:100828565-100828587 ATTTAAACCCCAGAGAAAACTGG + Intronic
1195588065 X:106588965-106588987 TGTTAAACCACTGAGATTATAGG - Intergenic
1195724746 X:107902942-107902964 AGTGAAACCCCTGGGCTGGCTGG - Intronic
1197702622 X:129610640-129610662 TGTTAAACCCCTGAGATTTCAGG - Intergenic