ID: 1122080075

View in Genome Browser
Species Human (GRCh38)
Location 14:99261022-99261044
Sequence TGAACACCCTGTCATCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080075_1122080080 -3 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080075_1122080078 -5 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080075_1122080079 -4 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080075_1122080084 19 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080075_1122080086 25 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080075 Original CRISPR TGAACACCCTGTCATCTCAG GGG (reversed) Intronic
900476425 1:2878445-2878467 TGAGCACCCTGCCATGCCAGGGG - Intergenic
900952821 1:5867538-5867560 TGCGCACCTAGTCATCTCAGAGG + Intronic
904875779 1:33653557-33653579 TGAGAGACCTGTCATCTCAGGGG - Intronic
912771139 1:112465133-112465155 AGGACACCCTGTCTGCTCAGAGG - Intergenic
913694995 1:121316159-121316181 TGGATACCCTTTCTTCTCAGTGG + Intronic
914001074 1:143694898-143694920 TGAACACCCTGTCAAATCTTAGG - Intergenic
914142566 1:144963899-144963921 TGGATACCCTTTCTTCTCAGTGG - Intronic
919003437 1:191864527-191864549 TGAACAACCTTGCATCTCTGGGG - Intergenic
920482328 1:206334542-206334564 TGGATACCCTTTCTTCTCAGTGG + Intronic
1063071085 10:2664922-2664944 TGATCTCACTGTCATCACAGTGG - Intergenic
1065726426 10:28671616-28671638 TGAACATCTTGTCTTCTTAGTGG - Intergenic
1070829691 10:79410837-79410859 TCAACCTCCTGCCATCTCAGGGG - Intronic
1072767801 10:98109850-98109872 GGTGCACCCTGTCAACTCAGTGG - Intergenic
1073117632 10:101100609-101100631 TGAAGACCCTGGGATCTTAGTGG - Intronic
1074326685 10:112457417-112457439 TGAACAACCTTTCAACTTAGAGG - Intronic
1074565688 10:114575680-114575702 TGCTCACCCTGTGATCTCAATGG + Intronic
1075876634 10:125812722-125812744 TCAACAAACTGTAATCTCAGAGG + Intronic
1075961620 10:126571914-126571936 TGGAATCCCTGTCCTCTCAGAGG + Intronic
1076585877 10:131547401-131547423 TGAACACCCTGTCCTGGCATGGG - Intergenic
1079040910 11:17058737-17058759 TGCACACCCTGTGATATCATTGG - Intergenic
1082266832 11:50128491-50128513 TGAACACTCTCTCATCCCTGTGG - Intergenic
1082289257 11:50350077-50350099 TGAACACTCTCTCATCCCTGTGG + Intergenic
1083715620 11:64574402-64574424 TGGGCACCCTGTTATCCCAGAGG + Intergenic
1083842020 11:65310037-65310059 TGGACACCCTGCTACCTCAGGGG - Intergenic
1085132131 11:74049590-74049612 TGTGCACCCTCTAATCTCAGTGG - Intronic
1088912364 11:114201317-114201339 TGCACACCTTGGCATCTCATTGG + Intronic
1089449178 11:118579844-118579866 TGAACATCATGTCATCACTGGGG + Intronic
1089756295 11:120689855-120689877 AGAACACCCTTTCATCTCCATGG + Intronic
1096183850 12:49565835-49565857 GTGATACCCTGTCATCTCAGAGG - Intronic
1099918259 12:88923724-88923746 TGAACAGCATGTCTTCTCACAGG - Intergenic
1100704630 12:97186729-97186751 TGATCACCTTCTCCTCTCAGGGG - Intergenic
1102251002 12:111387620-111387642 TGAACACCCAGGCATCTTTGTGG + Intergenic
1103744192 12:123111114-123111136 TGAAGACTTTGTCATCTCTGAGG - Intronic
1104132680 12:125909574-125909596 TGAAGACCCTGTGATTACAGTGG - Intergenic
1104711334 12:130988925-130988947 TGACCTCACTGTCATTTCAGGGG - Intronic
1108884421 13:55162401-55162423 TGAACACCCTGTCTTTATAGAGG - Intergenic
1109044981 13:57399114-57399136 TGAACACCCTTTCATCTATTTGG + Intergenic
1111485081 13:88887285-88887307 CGAACACCCTGTCATCTGTTAGG + Intergenic
1112655535 13:101448668-101448690 TGAATCCACAGTCATCTCAGGGG + Intergenic
1122080075 14:99261022-99261044 TGAACACCCTGTCATCTCAGGGG - Intronic
1122327544 14:100891507-100891529 GGCACTCCCTGTCACCTCAGTGG - Intergenic
1122724814 14:103743436-103743458 TAAAGAACCTGTCATTTCAGTGG - Intronic
1126644709 15:50863432-50863454 GGAACACCCTGCCATCTCCTGGG + Intergenic
1128806894 15:70537862-70537884 TGAGCTCCCTGTCATCAGAGTGG + Intergenic
1130017853 15:80201475-80201497 TGACTACCCTATCATCTCACAGG + Intergenic
1130967394 15:88707401-88707423 TGAACACCATGTGTTCTCACAGG - Intergenic
1131265498 15:90912915-90912937 TGAAGGCCCTTTCTTCTCAGAGG + Exonic
1134470362 16:14519545-14519567 GGAACATCTTGTCATCTCAGAGG + Intronic
1136243627 16:28960095-28960117 AGAACACCGTGTGATCACAGAGG - Intronic
1138750315 16:59411588-59411610 TGAACTCGCTGTCATCTCTTAGG + Intergenic
1139700933 16:68707616-68707638 TCACCACCCTGGCCTCTCAGTGG + Intronic
1141298702 16:82793245-82793267 TGCACACCTTGTCTTCTCACAGG - Intronic
1141904949 16:87018488-87018510 TGAACACACGGTAAACTCAGGGG - Intergenic
1149500727 17:57150371-57150393 TGATCACTCAGTCATCTAAGGGG + Intergenic
1154532521 18:15362142-15362164 TGACCACCTTTTCATCTCAGAGG + Intergenic
1155167625 18:23244350-23244372 TGCAAACCCTTTCATTTCAGTGG + Intronic
1156429850 18:37060179-37060201 AGAACAGCCTGTCATCACATAGG - Intronic
1157706381 18:49811094-49811116 TGAACACCCTGAAAATTCAGAGG + Intronic
1159196700 18:65125042-65125064 TTAACATTCTCTCATCTCAGAGG - Intergenic
1160489092 18:79321859-79321881 TGAACACCCTGTCATCTCACTGG - Intronic
1161404567 19:4084287-4084309 TGCACACCTGGTCAGCTCAGAGG + Intergenic
1164388986 19:27801332-27801354 TGAACACTCTTACATCTCACGGG + Intergenic
1164500193 19:28813050-28813072 AAAACAACCTGTTATCTCAGGGG + Intergenic
1166893341 19:46008103-46008125 TTAAAACCGTGGCATCTCAGAGG - Intronic
1167202073 19:48072855-48072877 TGGACACCGGGTCATCACAGAGG + Intronic
925250447 2:2431968-2431990 TTTCCACCCTGTGATCTCAGGGG + Intergenic
927007990 2:18870565-18870587 TAAACACCCCATCTTCTCAGTGG + Intergenic
927189550 2:20508081-20508103 TAAACAACCTCACATCTCAGTGG + Intergenic
927493610 2:23537264-23537286 TGAACACTCTGTTGCCTCAGTGG + Intronic
928394409 2:30932571-30932593 TGCACTCCCTGTGATCCCAGAGG + Intronic
929716851 2:44320657-44320679 TGAAGACACTGGCATTTCAGTGG + Exonic
932354018 2:71053426-71053448 TGAACACCCTGTGATGTTATTGG - Intergenic
935146573 2:100399552-100399574 TTAACAACCTGTCCTCCCAGGGG + Intronic
936284972 2:111174800-111174822 TGATCACCCTGAGGTCTCAGAGG - Intergenic
938910744 2:135883617-135883639 TGAGCTCCCTGTCAACCCAGTGG - Intergenic
942104313 2:172617529-172617551 AGAACACTGTGTCATCTGAGGGG + Intergenic
944310280 2:198225472-198225494 AGAACACCGTTCCATCTCAGAGG + Intronic
1171374669 20:24684344-24684366 GGAACACCCTGTCTGCTGAGAGG - Intergenic
1174723418 20:52837517-52837539 TGAACAGACTGTCCTCACAGGGG + Intergenic
1179970421 21:44834128-44834150 TGAACACACTGACAGATCAGAGG + Intergenic
1180914136 22:19473560-19473582 CGAAGACCCTGTCATTACAGAGG - Intronic
1181049096 22:20230359-20230381 CGAAGGCCCTGTCATCACAGTGG - Intergenic
1182825466 22:33260960-33260982 TGAAAACCCTGACATTTCTGGGG - Intronic
949381152 3:3447220-3447242 TGAATGCCTTGTCACCTCAGAGG - Intergenic
950610955 3:14126132-14126154 TGCACACCCTGGCCTCTCAAGGG - Intronic
952090303 3:29877273-29877295 TGAGCACTCTGGCATCTCATAGG + Intronic
955007610 3:54984148-54984170 AAAACACCGTGTCAGCTCAGAGG - Intronic
955473016 3:59306366-59306388 TGAATCCCCTCTCTTCTCAGGGG + Intergenic
956908699 3:73794646-73794668 TGAACACTCTCTCATCCCTGTGG - Intergenic
960950435 3:122995410-122995432 TGGCCACCCTGTCATCCCAGGGG - Intronic
965222226 3:165940646-165940668 TGGACACCACGGCATCTCAGTGG + Intergenic
966676197 3:182593199-182593221 AGAGCACCCTGTCTTCTCTGTGG + Intergenic
968748015 4:2370935-2370957 TGGGCACCGTGTCTTCTCAGTGG - Intronic
969876140 4:10136929-10136951 TGAATACCCTGTCATCAGATAGG + Intergenic
970936064 4:21571199-21571221 TGCTCAGCCTGTCATCTCAGAGG - Intronic
972356743 4:38286525-38286547 TGAAAACTCTGCCATTTCAGGGG - Intergenic
972410043 4:38784376-38784398 TCCACACCCTGTCATATCAGTGG + Intergenic
975332686 4:73135809-73135831 TGAATATCCTGTCATTCCAGAGG - Intronic
978502768 4:109426782-109426804 TAAACACCCTGCCATCATAGTGG + Intergenic
981692177 4:147521994-147522016 TGAACACACTGACAAATCAGTGG + Intronic
984045055 4:174786612-174786634 TCAACACCGTGTCATTTCATTGG - Intronic
985724782 5:1510425-1510447 TGAACACACTGTCATCTCGCAGG - Intronic
993351458 5:86855218-86855240 TTACCACTCTGTCATCTCAGTGG - Intergenic
997197660 5:131990519-131990541 AGAGCACCCAGACATCTCAGAGG + Intronic
999396166 5:151229846-151229868 TGAAGAACCTCTCAGCTCAGTGG + Intronic
999978355 5:156934830-156934852 AGAGCACTCTGTCTTCTCAGTGG + Intronic
1002722323 5:181270169-181270191 GGAACAACCTGCCAGCTCAGAGG - Intergenic
1002779864 6:357705-357727 TGACCACCCTGCCATCTAATGGG - Intergenic
1003389672 6:5702892-5702914 TGAACACAGTGACATCCCAGGGG - Intronic
1009224579 6:61010509-61010531 TACACCCCCTGTCATATCAGTGG + Intergenic
1009711127 6:67322069-67322091 TTAACCTCCTGTCATGTCAGAGG + Intergenic
1011157401 6:84348337-84348359 TGAACTCCCTGGCAAGTCAGTGG + Intergenic
1012662400 6:101918382-101918404 TGAACACTTTGTCATATCACAGG - Intronic
1021075941 7:16304783-16304805 TGAACTCCCTGACTTTTCAGGGG + Intronic
1021551240 7:21873342-21873364 TGAAAACCCTGTAATCTCTGTGG - Exonic
1023131615 7:37008950-37008972 TGAAAACCCTGTTATCCCACCGG - Intronic
1023639955 7:42247473-42247495 TAAACATCCTGAGATCTCAGGGG + Intergenic
1025025535 7:55513433-55513455 TGAATTCCCTATCGTCTCAGTGG + Intronic
1030158324 7:106480518-106480540 TTAACATCCTGGCTTCTCAGGGG + Intergenic
1030418368 7:109274006-109274028 TGAACACCCTTTCATATATGTGG + Intergenic
1032514606 7:132497395-132497417 TAAACACGATGTCATCTCAAGGG - Intronic
1035742169 8:1936800-1936822 TGCATCCTCTGTCATCTCAGAGG + Intronic
1041890913 8:62867623-62867645 TGACCACACAGTCAACTCAGAGG + Intronic
1048054811 8:130853193-130853215 TGGCTTCCCTGTCATCTCAGTGG - Intronic
1050402717 9:5272944-5272966 TGTACATCATGTCATTTCAGAGG - Intergenic
1053003598 9:34590732-34590754 TGAACACCCCGGCCCCTCAGAGG - Intergenic
1185699248 X:2217943-2217965 TGAACACACAGCCATCTCATGGG + Intergenic
1188097227 X:26039758-26039780 GGAACACTTTGACATCTCAGGGG - Intergenic
1188649055 X:32608012-32608034 TCAAGACTCTGTCATCTTAGAGG - Intronic
1190130749 X:47746630-47746652 GGACCACCCTGTCAGCACAGTGG + Intergenic
1192803733 X:74492374-74492396 TGAGCTCCCTGTCATCACCGAGG + Intronic
1192925176 X:75748294-75748316 TGAACACACAGTCATGTTAGGGG - Intergenic
1194696904 X:97063812-97063834 TGAACATCTTGTTATGTCAGGGG + Intronic