ID: 1122080076

View in Genome Browser
Species Human (GRCh38)
Location 14:99261023-99261045
Sequence GTGAACACCCTGTCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080076_1122080079 -5 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080076_1122080080 -4 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080076_1122080086 24 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080076_1122080078 -6 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080076_1122080084 18 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080076 Original CRISPR GTGAACACCCTGTCATCTCA GGG (reversed) Intronic
902730664 1:18366688-18366710 ATGAAAACCCTGTCATCTGTGGG + Intronic
904046181 1:27610028-27610050 GTGACCCGCCTGTAATCTCAGGG + Intergenic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
910005109 1:82386965-82386987 GTGTGCACACAGTCATCTCAGGG - Intergenic
911056277 1:93711025-93711047 GAGAACACCCAGTCAGCCCATGG - Intronic
913084668 1:115425768-115425790 GTGAACACCCTATAATCTTAGGG - Intergenic
915349459 1:155215309-155215331 GTGAAGATCCAGGCATCTCAAGG + Intergenic
915352657 1:155235991-155236013 GTGAAGATCCAGGCATCTCAAGG + Intronic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
917983396 1:180289481-180289503 GTGTACACTCTGACATCTAAAGG - Intronic
921634006 1:217470304-217470326 ATGAACAGCCTCTCATCTCTAGG - Intronic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
1065603230 10:27391142-27391164 GCAAACTCCCTCTCATCTCAAGG + Intergenic
1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG + Intergenic
1066980006 10:42404169-42404191 GGTAACACCCTCTCATCTAATGG - Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1070528247 10:77313399-77313421 GTGAAGGCCCTGTCCCCTCATGG - Intronic
1076231960 10:128827563-128827585 GTGACCCCCATGTAATCTCAAGG - Intergenic
1076585878 10:131547402-131547424 TTGAACACCCTGTCCTGGCATGG - Intergenic
1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG + Intergenic
1077376845 11:2209268-2209290 GTGACCACCCTGTCAGAGCAGGG + Intergenic
1079182308 11:18204540-18204562 GGGAAAAGCCTGTCTTCTCAGGG - Intronic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG + Intronic
1087175514 11:95091527-95091549 GGGAACACCCTGTGAGCTCTAGG - Intronic
1089372882 11:117973781-117973803 GTGAGCACCCAGTAATCACAAGG + Intergenic
1090717654 11:129444366-129444388 TTGAAAACCCTTTCATTTCAGGG - Intronic
1097404243 12:59169701-59169723 GTGAACACCCTGGAAAATCAAGG + Intergenic
1098520439 12:71430067-71430089 GAGAAGACCCTCTCATCCCAGGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1117532869 14:56676227-56676249 GGAAACACTCAGTCATCTCAAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1126310051 15:47305314-47305336 GTGATCACCAGGTCATCCCATGG - Intronic
1126644708 15:50863431-50863453 AGGAACACCCTGCCATCTCCTGG + Intergenic
1135341461 16:21651660-21651682 GTCAACCCCCTGCCATCACATGG + Intronic
1140801481 16:78492180-78492202 GTGCACACACTGTCACCTAATGG - Intronic
1141276765 16:82595390-82595412 CTGAAAACCCTTTCACCTCAAGG - Intergenic
1141904950 16:87018489-87018511 GTGAACACACGGTAAACTCAGGG - Intergenic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1149500726 17:57150370-57150392 GTGATCACTCAGTCATCTAAGGG + Intergenic
1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG + Intronic
1153232326 18:2950724-2950746 TTGGACACCATGTCATCTCTGGG - Intronic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1154507723 18:15059307-15059329 GTTAACACACTGTTTTCTCATGG - Intergenic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG + Intergenic
1159443244 18:68508486-68508508 GTGAGCACCCTGTTATCTAAAGG + Intergenic
1162085113 19:8244032-8244054 GTGAACCCAGTGTCATCACAAGG + Intronic
1162792488 19:13070238-13070260 CTGAGCACCCTGTCAGCTCGGGG - Intronic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG + Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
935053393 2:99543832-99543854 GTGCACACGCTGTTTTCTCATGG + Intergenic
935935537 2:108178530-108178552 ATGAACAACCTGCCATCACACGG + Intergenic
944526462 2:200624752-200624774 GAGAACATCCTATCATTTCATGG - Intronic
947295606 2:228627262-228627284 GTCAAATCCCTGTCATCCCATGG - Intergenic
947838714 2:233193763-233193785 GTGAAGACCCTGCCTTTTCATGG - Intronic
948084183 2:235232682-235232704 GTGACAACATTGTCATCTCATGG - Intergenic
948770944 2:240251007-240251029 GTGCCCACCCTTTCTTCTCAGGG - Intergenic
948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG + Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG + Intronic
1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG + Intergenic
1174723417 20:52837516-52837538 GTGAACAGACTGTCCTCACAGGG + Intergenic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG + Intergenic
1176790359 21:13312472-13312494 GTTAACACACTGTTTTCTCATGG + Intergenic
1177989531 21:28020711-28020733 GTTAACACACTGTTTTCTCATGG + Intergenic
1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG + Intergenic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1183867437 22:40714936-40714958 GTGCATACCCTTTGATCTCACGG + Intergenic
1185276792 22:49953403-49953425 CTGAACACCCTGTCCGCTCTTGG - Intergenic
950610956 3:14126133-14126155 ATGCACACCCTGGCCTCTCAAGG - Intronic
950890313 3:16398772-16398794 CATAACACTCTGTCATCTCAAGG - Intronic
954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG + Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
964036866 3:152209592-152209614 GTAAGCACCTTCTCATCTCAAGG - Intergenic
970870135 4:20807337-20807359 GTGAAGACCCTGTAATCACATGG + Intronic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
973174771 4:47191603-47191625 GTGAAAACACTGTTATCTAAGGG - Intronic
979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG + Intronic
980655374 4:135776094-135776116 GTGATCAGTCTGGCATCTCATGG + Intergenic
986597638 5:9440054-9440076 GTGAGCACCCTGTCTTCCCCAGG - Intronic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG + Intergenic
1001050966 5:168414213-168414235 TTGATCAGCTTGTCATCTCAAGG - Intronic
1002779865 6:357706-357728 TTGACCACCCTGCCATCTAATGG - Intergenic
1003389673 6:5702893-5702915 GTGAACACAGTGACATCCCAGGG - Intronic
1007695287 6:43728501-43728523 GTGAACACACAGTCATCACTCGG + Intergenic
1012599849 6:101082170-101082192 GTGATCACCCTCTCAAATCAAGG - Intergenic
1015202894 6:130602683-130602705 ATGAACGCCCTTTCATCTGAGGG + Intergenic
1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG + Intronic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG + Intergenic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1034646572 7:152652977-152652999 GTGAGCACCCTGTGGTCTCTGGG - Intronic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1046949268 8:120004191-120004213 GAGAAAACTCTGTCATCTAATGG + Intronic
1047852686 8:128875883-128875905 GTGAAGACCCTATAATCTAATGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1185699247 X:2217942-2217964 CTGAACACACAGCCATCTCATGG + Intergenic
1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG + Intergenic
1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG + Intergenic
1198175055 X:134146726-134146748 GTTGACACTCTGTCATCTCCTGG + Intergenic