ID: 1122080077

View in Genome Browser
Species Human (GRCh38)
Location 14:99261024-99261046
Sequence GGTGAACACCCTGTCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080077_1122080080 -5 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080077_1122080086 23 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080077_1122080084 17 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080077_1122080078 -7 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080077_1122080079 -6 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080077 Original CRISPR GGTGAACACCCTGTCATCTC AGG (reversed) Intronic
902730663 1:18366687-18366709 AATGAAAACCCTGTCATCTGTGG + Intronic
904046180 1:27610027-27610049 GGTGACCCGCCTGTAATCTCAGG + Intergenic
908717674 1:67087572-67087594 GGTGGACACCCTGCCAGATCTGG - Intergenic
913084669 1:115425769-115425791 AGTGAACACCCTATAATCTTAGG - Intergenic
919003439 1:191864529-191864551 GTTGAACAACCTTGCATCTCTGG - Intergenic
922701755 1:227765353-227765375 GGGGGCCACCCTGTGATCTCAGG + Intronic
1068368137 10:56078142-56078164 TGTGAACACCCTGTTTTATCAGG - Intergenic
1071103326 10:82064221-82064243 GGTGAATTTCCTGTGATCTCAGG - Intronic
1075152550 10:119947509-119947531 AGTGACCACCCTGTTATTTCAGG - Intergenic
1076083125 10:127601251-127601273 GGTGTGCAACCTGTCATCCCAGG + Intergenic
1077228796 11:1449619-1449641 GCTGCACACCCTGTCAATTCAGG - Intronic
1077376844 11:2209267-2209289 GGTGACCACCCTGTCAGAGCAGG + Intergenic
1077476559 11:2793050-2793072 GGTGAACACCCCGTCAGGGCAGG + Intronic
1078332737 11:10439248-10439270 GGGGAAAACCCTTTCAGCTCAGG - Intronic
1080394608 11:31878339-31878361 AGTGACCAGCCTGTGATCTCTGG + Intronic
1081448093 11:43149205-43149227 GGTGTACACCCTGTGATATTGGG + Intergenic
1084044484 11:66560799-66560821 TGTGACCACCCTGAAATCTCGGG + Intronic
1084651533 11:70492234-70492256 GGTGCACACGCTTTCATGTCTGG - Intronic
1087648030 11:100830794-100830816 GGTGAACAATTTGTCAGCTCGGG + Intronic
1092273405 12:7040794-7040816 GGTTAACTCCCTGTCACCCCTGG - Intronic
1095202571 12:39401505-39401527 TGTGAACACCCTTTAATCTTTGG - Intronic
1097174683 12:57135908-57135930 GGTGACCACCCGGTGACCTCAGG + Intronic
1097363151 12:58680235-58680257 GGAGAACACCCTGTCAGTACCGG - Intronic
1097491103 12:60270874-60270896 GGTGAACAGCAAGCCATCTCTGG + Intergenic
1098285330 12:68901330-68901352 GGTGAACAACCTGACCTCTCTGG - Intronic
1099179506 12:79460907-79460929 GGTGTACACCCTGTGATATTAGG - Intergenic
1099180074 12:79466296-79466318 GGTGTACACCCTGTGATATTAGG + Intergenic
1100523701 12:95400439-95400461 AGTGTACACCCAGCCATCTCTGG + Intergenic
1103715726 12:122944458-122944480 GGGGGCCACCTTGTCATCTCAGG - Exonic
1103984861 12:124760474-124760496 GGTGAACGACCTGACTTCTCTGG + Intergenic
1105733029 13:23238313-23238335 GGTGAAGTCTCTGCCATCTCTGG - Intronic
1106406256 13:29477277-29477299 TCTCAACACCCAGTCATCTCAGG + Intronic
1112234863 13:97626185-97626207 GGTGAACATCCTCTCATGGCAGG - Intergenic
1114927201 14:27418609-27418631 GGTGAAACCTCTGTCATCTTAGG - Intergenic
1118379350 14:65204956-65204978 GGTGGAGACCCAGTCATATCAGG - Intergenic
1119625654 14:76172629-76172651 AGTGATGACCCTGTCATCCCAGG - Intronic
1122080077 14:99261024-99261046 GGTGAACACCCTGTCATCTCAGG - Intronic
1126562295 15:50057252-50057274 GCTGAACACTATATCATCTCAGG + Intronic
1128099534 15:64987694-64987716 TGTGGACTCCCTGTCTTCTCTGG + Intronic
1130233658 15:82114878-82114900 TATGACCACCCTGTCATCTCTGG + Intergenic
1131022558 15:89111622-89111644 GGTGAACTCCCTGCCCTCTAAGG + Intronic
1131073111 15:89478083-89478105 GGTGAACTCCCAGCCATCCCCGG - Intronic
1138456188 16:57122109-57122131 TGGGGACACCCTGTCCTCTCTGG + Intronic
1138903795 16:61305724-61305746 AGAGAACACCCTGACTTCTCTGG + Intergenic
1140762041 16:78118451-78118473 GATGAACAAACTGCCATCTCTGG + Intronic
1141841106 16:86574689-86574711 GCTGCACACCCTCTCCTCTCTGG + Intergenic
1141904951 16:87018490-87018512 GGTGAACACACGGTAAACTCAGG - Intergenic
1145827002 17:27884589-27884611 GGTGCTCACCCTGTCCTCTGTGG + Intronic
1145893567 17:28436783-28436805 CGTGAACAAGCTGTCCTCTCTGG + Intergenic
1146947786 17:36885529-36885551 GTTTAACACGCTGTCACCTCGGG + Intergenic
1147176413 17:38658794-38658816 GGAGAGCCCCCTGTCATGTCTGG - Intergenic
1149709195 17:58723867-58723889 GGTAAAAACCTTGTAATCTCAGG + Intronic
1151572895 17:74936078-74936100 GGTGAACTCCCTTTAATCTGAGG + Intronic
1152760976 17:82106911-82106933 GGTGGGCACCCTAGCATCTCAGG + Intronic
1153232327 18:2950725-2950747 GTTGGACACCATGTCATCTCTGG - Intronic
1155319756 18:24607627-24607649 GGTGCCCAGCCTCTCATCTCTGG - Intergenic
1157787236 18:50494900-50494922 GATGAAAACCCTTTGATCTCAGG + Intergenic
1159023404 18:63161562-63161584 GGTGAACACCAAGCCATCTGAGG - Intronic
1159873260 18:73782573-73782595 GGTGATCCCACAGTCATCTCAGG - Intergenic
1160278225 18:77459691-77459713 GGGGAACAGCCTGTCAACTAGGG + Intergenic
1162792489 19:13070239-13070261 TCTGAGCACCCTGTCAGCTCGGG - Intronic
1164982988 19:32628108-32628130 GGTGTGCCCCCTGTCGTCTCTGG + Exonic
1165060729 19:33204135-33204157 GGTTGACAGCTTGTCATCTCCGG - Intronic
1165322850 19:35096916-35096938 GGGGAGCACCTTGTCATCACTGG - Intergenic
1166648248 19:44548998-44549020 GGTGAGGACCCTGCCATCTCTGG + Intergenic
925153608 2:1634339-1634361 GGAGCACAGCCTGTCAGCTCTGG + Intronic
933729064 2:85443699-85443721 GATGATCACCATGTCATCACTGG + Intergenic
942050525 2:172136327-172136349 AGCGCACACCGTGTCATCTCTGG + Intergenic
942804233 2:179910909-179910931 GCTGCATACCCTGTCCTCTCTGG + Intergenic
943612688 2:190052176-190052198 GGGGAACACCAGGTCATCTTGGG - Intronic
944481410 2:200161189-200161211 GGTGAACACACTGATATCTCAGG - Intergenic
944664219 2:201946201-201946223 TGTGCACACTCTATCATCTCTGG + Intergenic
1170966305 20:21074960-21074982 GCTGATCACCCTGTTCTCTCTGG + Intergenic
1171500782 20:25591438-25591460 AGTGAACACCCTGCCAGATCCGG + Intergenic
1172216669 20:33240414-33240436 GCATCACACCCTGTCATCTCTGG - Intronic
1172980993 20:38941562-38941584 GGGTAACACACTGTCATCTTTGG - Intronic
1173521547 20:43703725-43703747 GGAGGCCACCCTGTCATCACGGG + Intronic
1175182656 20:57159582-57159604 GGTGAGCCCCATGTCATCACAGG + Intergenic
1175396872 20:58670829-58670851 GGTCAACACCCTGCCTTCTTAGG + Intronic
1175714205 20:61244848-61244870 GGAGAACCCCATGTCATCTCTGG + Intergenic
1183152645 22:36050033-36050055 GCTGAACATCATGTCACCTCTGG - Intergenic
1183236741 22:36624422-36624444 GGTGAGCAGCCTGACCTCTCTGG - Intronic
949403823 3:3693920-3693942 GGAGAATACTCAGTCATCTCAGG - Intergenic
950679894 3:14577892-14577914 GGTGCAAACCCTCTCAGCTCTGG + Intergenic
952952657 3:38537597-38537619 GGTGAAGACACTGGCGTCTCTGG - Intronic
952958544 3:38575691-38575713 GGTGAACAGCCTGGCAGGTCTGG + Intronic
957042471 3:75346614-75346636 GGTGAACACCCCGTGACCTGAGG - Intergenic
958747240 3:98152043-98152065 TGTGAAAACCTTGTCATCACTGG + Intergenic
960544020 3:118891363-118891385 GGTGAACACACCTTGATCTCTGG + Intergenic
960950437 3:122995412-122995434 TGTGGCCACCCTGTCATCCCAGG - Intronic
962702212 3:138010533-138010555 GGTGAGGACCCTGGCAGCTCTGG + Intronic
968274554 3:197429997-197430019 TGTGAACACCCTGTCATGGAGGG - Intergenic
975342456 4:73258030-73258052 GGTGAACAGCCTGTTATCATGGG - Intronic
985930738 5:3055704-3055726 GGTGAACACCACGTCAAGTCTGG - Intergenic
986161309 5:5231916-5231938 GCTCAACACCTTGTCATTTCAGG - Intronic
997612598 5:135225707-135225729 GGTGACCTCCCTGTCCTCTCTGG + Intronic
997681328 5:135753597-135753619 TGTGTACACCCTGTTATATCAGG - Intergenic
998355596 5:141533182-141533204 GGAAAATACCCTTTCATCTCTGG + Intronic
998518659 5:142780306-142780328 TGTGAACATCCTGGCACCTCTGG + Intronic
1002284125 5:178151002-178151024 AGAGAAAACACTGTCATCTCTGG + Intronic
1003389674 6:5702894-5702916 GGTGAACACAGTGACATCCCAGG - Intronic
1008339081 6:50343259-50343281 TGTGAGCATCCTATCATCTCTGG - Intergenic
1008412581 6:51197706-51197728 GGTGAACTCTCTGTCTTCTAAGG - Intergenic
1023885162 7:44349056-44349078 GGTGAACACCCTTATGTCTCTGG - Intergenic
1026764785 7:73153849-73153871 GGTGAAAAGCCTGTAATCTGTGG - Intergenic
1027041258 7:74963619-74963641 GGTGAAAAGCCTGTAATCTGTGG - Intergenic
1027082382 7:75238757-75238779 GGTGAAAAGCCTGTAATCTGTGG + Intergenic
1034646573 7:152652978-152653000 TGTGAGCACCCTGTGGTCTCTGG - Intronic
1035186505 7:157130205-157130227 GGTGGACCCCATGTCATCCCAGG + Intergenic
1037209380 8:16367252-16367274 GGTGAATACCCTGACATCTTTGG - Intronic
1037889534 8:22616248-22616270 GGTGAGTACCCTGCCACCTCGGG + Exonic
1038965222 8:32564733-32564755 GGTGATCAGCCTTTCTTCTCTGG + Intronic
1039738833 8:40361089-40361111 GGTGAACATCTAGACATCTCTGG + Intergenic
1041691171 8:60688835-60688857 TGAGAACACCCTGTGACCTCTGG - Intronic
1055129870 9:72762699-72762721 GGTGAGGACCCTCTCATCTGTGG + Intronic
1056864560 9:90218174-90218196 GGTGAACGCCCTGTGATCTGAGG + Intergenic
1057740162 9:97704237-97704259 TGTTCATACCCTGTCATCTCAGG - Intergenic
1186211987 X:7259466-7259488 GGTGAAGACACTGCCCTCTCCGG - Exonic
1197075782 X:122350879-122350901 GCAGTACACCCTGTGATCTCTGG + Intergenic