ID: 1122080078

View in Genome Browser
Species Human (GRCh38)
Location 14:99261040-99261062
Sequence GTTCACCCGATTCCAAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080071_1122080078 20 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080069_1122080078 24 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080072_1122080078 19 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080068_1122080078 25 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080067_1122080078 29 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080076_1122080078 -6 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080075_1122080078 -5 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080070_1122080078 23 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68
1122080077_1122080078 -7 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG 0: 1
1: 0
2: 1
3: 10
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080078 Original CRISPR GTTCACCCGATTCCAAAGAA CGG Intronic
902876983 1:19346540-19346562 GTTCTCCTGGTTCCAAAGAGAGG - Intronic
920736333 1:208536288-208536310 CTTCACCCCATGCCAGAGAAAGG + Intergenic
1064924318 10:20553271-20553293 CTTCACACGTGTCCAAAGAATGG + Intergenic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG + Intronic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG + Intergenic
1069778347 10:70939736-70939758 GTCCAAAGGATTCCAAAGAAAGG + Intergenic
1072120536 10:92402058-92402080 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1083097438 11:60266193-60266215 GTTCACCAGAGTGCAGAGAATGG - Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1085603249 11:77874561-77874583 GTGCACCAGGTTCCAAAGTAGGG - Intronic
1087553452 11:99682619-99682641 GTTCAACCTATTACACAGAACGG - Intronic
1090344191 11:126054779-126054801 GTTCAGCAGAGTGCAAAGAAAGG + Intronic
1094474556 12:30831389-30831411 GTTAACCCAATTTCATAGAAAGG - Intergenic
1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG + Intergenic
1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107103145 13:36615624-36615646 GTTCATCCAATCCCAAAGCAGGG - Intergenic
1110632914 13:77730314-77730336 GTTCACCAGATTTCCAAAAAAGG - Intronic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1116974200 14:51097315-51097337 GTTCACCCTGTTCCAAACAGGGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG + Intergenic
1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG + Intronic
1135566157 16:23512640-23512662 GTTCAAACCAGTCCAAAGAATGG - Intronic
1138334882 16:56245243-56245265 GCTCACCAGATTTCTAAGAATGG - Intronic
1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG + Intronic
1146303764 17:31713575-31713597 ATGCAAACGATTCCAAAGAACGG + Intergenic
1150124004 17:62625131-62625153 CTTCATCTGCTTCCAAAGAAGGG - Intergenic
1152397101 17:80040158-80040180 GTCCACCAGAATCCAGAGAAAGG + Exonic
1158036472 18:53037707-53037729 GTCCACCTGATTTCAAAGACCGG - Intronic
926364565 2:12121424-12121446 GTTTACCAGATGCCCAAGAAGGG + Intergenic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
942447702 2:176088960-176088982 GTTCTCTCCATCCCAAAGAAGGG + Intergenic
943932736 2:193875933-193875955 ATTCACTGAATTCCAAAGAATGG - Intergenic
944627300 2:201584425-201584447 GTTAACCAGAGTCCAAGGAAAGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1171015093 20:21533443-21533465 GTTTTCCAGAATCCAAAGAAGGG + Intergenic
1172533687 20:35653797-35653819 GTTCATCCAATTACTAAGAAAGG - Exonic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1179214724 21:39357609-39357631 GTTCACCGAATCCCAAAGCATGG - Intergenic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
962407853 3:135115644-135115666 GTTTACCTGATTCCACAGTAGGG - Intronic
963235864 3:142955251-142955273 GTTCACCCATTTCCAAACAAAGG - Intronic
965472884 3:169116894-169116916 TTTCACTAGATTCCAAAGCAAGG + Intronic
971062372 4:22986852-22986874 GTGCACCTGACTCCAAAGATTGG - Intergenic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
974266136 4:59588067-59588089 GTTCACTGGATGCCAAAAAAGGG - Intergenic
975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG + Exonic
978714762 4:111828109-111828131 GTTCACCAGAATACAAAGGAAGG - Intergenic
987919660 5:24263050-24263072 TATCACCCTATTCCAAATAATGG - Intergenic
989582704 5:43047926-43047948 CTTCACCAGATTCCACAGAGTGG + Intergenic
992658287 5:78932092-78932114 TTTCACCCAATTCCAAAAGATGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG + Intergenic
1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG + Intergenic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1007296562 6:40826740-40826762 GTTCAGCCAATGCAAAAGAAGGG - Intergenic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1016458404 6:144256439-144256461 ATTAACCTGATTCCAAAGACTGG - Intergenic
1017051772 6:150400061-150400083 GTTCACCTGAATCCCAAGCAGGG - Exonic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1025505133 7:61416363-61416385 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1025505966 7:61430201-61430223 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1025510480 7:61506784-61506806 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1043250790 8:78070722-78070744 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1045890783 8:107154600-107154622 GTTCAATACATTCCAAAGAAGGG + Intergenic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1051142669 9:13994663-13994685 GTTCATCCAATCCCAAAGCATGG - Intergenic
1190759521 X:53427986-53428008 ATCCACCTGATCCCAAAGAAAGG - Exonic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic
1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG + Intergenic
1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG + Intergenic