ID: 1122080079

View in Genome Browser
Species Human (GRCh38)
Location 14:99261041-99261063
Sequence TTCACCCGATTCCAAAGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 60}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080071_1122080079 21 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080077_1122080079 -6 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080067_1122080079 30 Left 1122080067 14:99260988-99261010 CCTTCCCCTCCCACTTTCAGCGT 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080076_1122080079 -5 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080072_1122080079 20 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080070_1122080079 24 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080068_1122080079 26 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080075_1122080079 -4 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1122080069_1122080079 25 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG 0: 1
1: 0
2: 1
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080079 Original CRISPR TTCACCCGATTCCAAAGAAC GGG Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
907043080 1:51280942-51280964 CTTACCCCATTCCCAAGAACAGG - Intergenic
908550370 1:65202649-65202671 TTCATCCAATTCCCAGGAACTGG - Intronic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
912408632 1:109464722-109464744 TTATCCCTATTCCATAGAACAGG + Intergenic
913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG + Intergenic
916694869 1:167223855-167223877 TGCACCCGATTCCCAAGATGTGG + Intronic
1067250382 10:44581611-44581633 TTCACCCCATCCCAGAGGACAGG + Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1070373014 10:75803400-75803422 TTCACCCTGTTACCAAGAACAGG - Intronic
1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG + Intronic
1076894416 10:133302834-133302856 TTGACCTGCTTCAAAAGAACAGG - Exonic
1079245309 11:18747951-18747973 CTCACCCCACCCCAAAGAACTGG - Intronic
1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG + Intergenic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1099428671 12:82553977-82553999 TTCACCCTATCCCAAAGCCCAGG - Intergenic
1100226014 12:92556357-92556379 TTCAAAGGATTCCACAGAACAGG - Intergenic
1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG + Intronic
1105221067 13:18327962-18327984 GTCACCCCATTCCAAAGCATGGG - Intergenic
1111474346 13:88725582-88725604 TTCACTCCAGTCCACAGAACTGG - Intergenic
1113838514 13:113345744-113345766 TTCACCCGGAGCCAAAGCACTGG + Intronic
1115756013 14:36526294-36526316 TTGACCAGAGTCCAAAGAAGGGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124810512 15:32932817-32932839 TACAACCGATGCCACAGAACTGG - Intronic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG + Intronic
1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG + Intronic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG + Intergenic
1153051089 18:904148-904170 TTCACCCGTTTCTCAAGGACAGG - Intergenic
1156285690 18:35693327-35693349 TTCACTCTATTCCAGACAACTGG - Intronic
1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG + Intronic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
934182990 2:89644506-89644528 GTCACCCCATTCCAAAGCATGGG + Intergenic
934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG + Intergenic
936980881 2:118264095-118264117 TCCTCCTGATTCCAATGAACAGG + Intergenic
941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG + Intergenic
948717161 2:239872275-239872297 TTCCCCCGATTCCAGAAGACAGG + Intergenic
1169982672 20:11404088-11404110 TACACACGATTCCAAAGGCCTGG + Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1182970471 22:34569744-34569766 TTCCCCCATTTCCAAAGTACAGG + Intergenic
1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG + Intronic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG + Intergenic
989582705 5:43047927-43047949 TTCACCAGATTCCACAGAGTGGG + Intergenic
992638887 5:78751632-78751654 TTCACCCGACTTCAAAGGGCAGG - Intronic
994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG + Intergenic
1005653805 6:27911509-27911531 TTCACCCAGCTCCAAAGACCGGG - Exonic
1012965261 6:105667081-105667103 TTCACCGGATTCCACACATCTGG - Intergenic
1017024150 6:150166902-150166924 TTCACTCGGTTCCAAATGACTGG - Intronic
1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG + Intergenic
1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG + Intergenic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1024919764 7:54544897-54544919 GTCACTCGCTTCCACAGAACCGG - Intronic
1031048225 7:116918235-116918257 TTGACCCCATTAAAAAGAACTGG - Exonic
1032734303 7:134676830-134676852 GTCACCTGACTCCAAACAACAGG + Intronic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1190119553 X:47649417-47649439 TTCCCCCAATTACAAAGCACTGG + Intronic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1196890820 X:120289020-120289042 TTCACCCAAGTCAAAGGAACAGG + Intronic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic