ID: 1122080080

View in Genome Browser
Species Human (GRCh38)
Location 14:99261042-99261064
Sequence TCACCCGATTCCAAAGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080076_1122080080 -4 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080069_1122080080 26 Left 1122080069 14:99260993-99261015 CCCTCCCACTTTCAGCGTTGAAA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080072_1122080080 21 Left 1122080072 14:99260998-99261020 CCACTTTCAGCGTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080070_1122080080 25 Left 1122080070 14:99260994-99261016 CCTCCCACTTTCAGCGTTGAAAG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080068_1122080080 27 Left 1122080068 14:99260992-99261014 CCCCTCCCACTTTCAGCGTTGAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080071_1122080080 22 Left 1122080071 14:99260997-99261019 CCCACTTTCAGCGTTGAAAGTTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080077_1122080080 -5 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1122080075_1122080080 -3 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080080 Original CRISPR TCACCCGATTCCAAAGAACG GGG Intronic
902575129 1:17372781-17372803 GCACCCAATTCCCAAGAAGGGGG - Intronic
905966020 1:42096282-42096304 TCACACTATTGCAAAGAACTTGG - Intergenic
907043079 1:51280941-51280963 TTACCCCATTCCCAAGAACAGGG - Intergenic
908938200 1:69400854-69400876 TCAGCCGATTCCAAGGCAGGGGG + Intergenic
909706441 1:78590618-78590640 TCACCAGAATCCAATGAAAGTGG + Intergenic
910529678 1:88221519-88221541 TCACCACATTCCACAGAACTAGG - Intergenic
1068333058 10:55597974-55597996 TCACCTGGTTCAAAAGAAGGAGG + Intronic
1068647389 10:59482594-59482616 TAACCAGATTTCAAAGAATGGGG - Intergenic
1069616839 10:69811600-69811622 TCACCCGACTCCATAGAATCAGG + Intronic
1095139885 12:38648553-38648575 GCACCAGATTTCAAAGAAAGTGG - Intronic
1115756012 14:36526293-36526315 TGACCAGAGTCCAAAGAAGGGGG - Intergenic
1122080080 14:99261042-99261064 TCACCCGATTCCAAAGAACGGGG + Intronic
1135840079 16:25868219-25868241 TCACAGGATTCCAGAGAAAGTGG - Intronic
1136108191 16:28046169-28046191 TCACCAGATGCCAAAAAACATGG + Intronic
1137679529 16:50327815-50327837 TCCCCCGACTCCATAGAACAAGG + Intronic
1148620478 17:49031061-49031083 TCAGCCGGTTCCCAAGAAAGTGG - Intronic
1153930963 18:9879311-9879333 TCACCCTATTTCCAAAAACGAGG + Intergenic
1159893204 18:73972363-73972385 ACACCCGATTCTGAAGAACAAGG + Intergenic
1163838814 19:19593163-19593185 TCAAGCGATTCCAAAGTACTGGG + Intronic
926903319 2:17781697-17781719 TCATCCCATTTCAAAGAAAGTGG + Exonic
932578482 2:72977029-72977051 TGACCCGATTCCAGACAACCAGG + Intronic
936474967 2:112831972-112831994 CTACCCGATTCCAAAGAAACAGG + Intronic
948801310 2:240434889-240434911 TCTCCAGCATCCAAAGAACGTGG + Intergenic
1175712848 20:61234934-61234956 TCGCCCGAATCTAAAGAACTTGG - Intergenic
949569615 3:5280069-5280091 TCAACCTATTCCAAAAAATGTGG - Intergenic
952914619 3:38224598-38224620 ACACCAGTTTCCAAAGAAGGAGG - Exonic
958007268 3:87827787-87827809 TCACCCTTTTCCAATCAACGAGG - Intergenic
965381212 3:167991356-167991378 GCACCCGAGTACAAAGAACTTGG - Intergenic
968186628 3:196637183-196637205 TCACCTGATCCCAAAGGTCGAGG + Intergenic
970319815 4:14863854-14863876 TCAATCGATTACAAAGAAAGAGG - Intergenic
970781939 4:19748034-19748056 TCAGTTGATTCCAAAGAAAGGGG + Intergenic
973539601 4:51922941-51922963 TCACCAGATTCCAACCAAAGTGG + Intergenic
976455615 4:85243917-85243939 AAACCCAATTCCAAAGAACTTGG - Intergenic
989582706 5:43047928-43047950 TCACCAGATTCCACAGAGTGGGG + Intergenic
1005653804 6:27911508-27911530 TCACCCAGCTCCAAAGACCGGGG - Exonic
1024919763 7:54544896-54544918 TCACTCGCTTCCACAGAACCGGG - Intronic
1037319647 8:17630975-17630997 TCACCTGACTCCAGAGCACGTGG + Intronic
1040574292 8:48637487-48637509 TCACCTCATTCCAAAGAGCATGG - Intergenic
1053129847 9:35608726-35608748 TCACCCCTTTCCAAAGCACCAGG + Intronic
1053422623 9:37989314-37989336 TCTCCTGACCCCAAAGAACGAGG + Intronic
1193780113 X:85691071-85691093 TGACCCCATCCCAAAGAAAGTGG - Intergenic
1198747491 X:139905049-139905071 TCACCCAATTCCACAGATTGTGG - Intronic