ID: 1122080084

View in Genome Browser
Species Human (GRCh38)
Location 14:99261064-99261086
Sequence GTTTCCTCTCCCCACCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 359}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080077_1122080084 17 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080081_1122080084 -4 Left 1122080081 14:99261045-99261067 CCCGATTCCAAAGAACGGGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080076_1122080084 18 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080082_1122080084 -5 Left 1122080082 14:99261046-99261068 CCGATTCCAAAGAACGGGGTTTC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359
1122080075_1122080084 19 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080084 Original CRISPR GTTTCCTCTCCCCACCACCC AGG Intronic
900534989 1:3172334-3172356 GTTGACTTCCCCCACCACCCTGG - Intronic
901643497 1:10704830-10704852 GGTTTCTCGCGCCACCACCCCGG + Intronic
902098046 1:13962514-13962536 GTTTACTTTCCCAACAACCCCGG + Intergenic
902224542 1:14988370-14988392 GTTTTCTCTCCCCACCCTGCTGG + Intronic
902480257 1:16707857-16707879 GTCTCCCCTCCGCACCGCCCGGG + Intergenic
903181793 1:21608575-21608597 GCTTCATGTCCCCACCCCCCAGG + Intronic
903347731 1:22698000-22698022 CTTTCCACTCCCACCCACCCTGG - Intergenic
904774932 1:32900915-32900937 GTCTCCTCTGCCGCCCACCCGGG + Intronic
904859092 1:33521409-33521431 GGTTTCTCTCCCACCCACCCGGG + Intronic
905270931 1:36786995-36787017 GTTTACTCTCACCCCCACACTGG + Intergenic
905273425 1:36801803-36801825 CTTTCCTCTGCCCAGCCCCCAGG + Exonic
907328425 1:53656017-53656039 GTGGCCTCTCCCCATCACCAGGG + Intronic
907389928 1:54151590-54151612 GCTACCTCCTCCCACCACCCAGG + Intronic
907431087 1:54411929-54411951 GGTTCCTCTCCCCAGCTACCAGG - Intronic
908061830 1:60358523-60358545 GTGTGCTGTGCCCACCACCCTGG + Intergenic
909664132 1:78114886-78114908 GCTCCCTATCCCCACCACACAGG - Intronic
911182952 1:94877183-94877205 GTTTCCTCTTCCCCCAGCCCAGG + Intronic
912490513 1:110060261-110060283 GCTTCCCCTCCCCACCAGCAGGG - Exonic
914713146 1:150233495-150233517 GTTACTTCTCCCTACCACTCTGG + Intronic
915559400 1:156677529-156677551 GGTTCCACTCTCCAGCACCCTGG - Intergenic
916651145 1:166835818-166835840 GTTTTCTCTCCCCTTCACTCTGG + Intergenic
916752550 1:167736610-167736632 CTTTCCTCACCTCACCTCCCTGG + Intronic
917497830 1:175557486-175557508 ATTCCCTCTCCCCAGCACCTTGG + Intronic
919157075 1:193779234-193779256 GTTACTCCTCCCCACCAACCTGG - Intergenic
919791705 1:201295177-201295199 CTCTCCTCTCCCCAGGACCCAGG - Intronic
922405320 1:225306550-225306572 GTGTCCCCTCCCCATCATCCAGG + Intronic
922562661 1:226580403-226580425 AGATCCTCTCCCCTCCACCCAGG - Intronic
922723475 1:227910730-227910752 GATTCCCTTCCTCACCACCCAGG + Intergenic
922766728 1:228159980-228160002 GTCTCCTCTCCCAGCCAGCCTGG - Intergenic
923015143 1:230120707-230120729 GTTTTCTCTCCCAAGCAGCCTGG - Intronic
1063474153 10:6313945-6313967 GCCTCCTCTGCCCACCACCTTGG - Intergenic
1063850572 10:10185124-10185146 TTTTTCACCCCCCACCACCCCGG + Intergenic
1063964308 10:11334742-11334764 GTTTCCTCTCCACACCCACGAGG + Exonic
1064268823 10:13847431-13847453 GCTTCCTCCCTCCACCACCAGGG + Intronic
1064316497 10:14262642-14262664 CTTTCTGCTCCTCACCACCCAGG - Intronic
1064339528 10:14473922-14473944 CGTTCCTCTGCCCACCCCCCTGG + Intergenic
1066237325 10:33498655-33498677 GTTACCTCTCCCCCTCAGCCAGG + Intergenic
1067054793 10:43044265-43044287 GTTGCCTGTCCTCACCTCCCTGG - Intergenic
1067384496 10:45806103-45806125 GTTTCCTGCCCACACAACCCTGG + Intergenic
1067831575 10:49613917-49613939 CCCTCCTCTCCCCACCATCCAGG - Intronic
1067892188 10:50146665-50146687 GTTTCCTGCCCACACAACCCTGG + Intergenic
1068813709 10:61285909-61285931 GCTTCCTCTCCCTACCACGTGGG + Intergenic
1069887313 10:71632044-71632066 GTTACCTATCCCCTCCAACCAGG - Intronic
1071568218 10:86682372-86682394 GCTTCCTCGCCACCCCACCCTGG - Intronic
1072153356 10:92701054-92701076 GTTCTCTCTACCCACCACACAGG + Intergenic
1072189346 10:93067481-93067503 CTGTCCTCTGCTCACCACCCTGG - Intronic
1072746457 10:97942470-97942492 GTTTTCTCTCCTCCTCACCCAGG - Intronic
1074160057 10:110829689-110829711 CTTTCCTCCTCCCACCTCCCAGG - Intronic
1074367864 10:112874615-112874637 GATTCCTCCCACCACCACCATGG + Intergenic
1075559073 10:123455542-123455564 ATTTCCTCTCCCCATCAGCCTGG - Intergenic
1075823874 10:125336960-125336982 GTTTCCTGCCCCCACCACTCTGG + Intergenic
1075956086 10:126524454-126524476 GATTCCTGTCCCCGCTACCCAGG - Intronic
1076172008 10:128327188-128327210 ACTTCCTCTCCCCGCCAACCTGG + Intergenic
1076491373 10:130863886-130863908 AGTTTCTATCCCCACCACCCTGG - Intergenic
1077025728 11:439079-439101 GTGTCCTCACCCCAGCCCCCAGG + Intronic
1077298285 11:1836063-1836085 CTGTCAGCTCCCCACCACCCAGG - Intronic
1077324008 11:1955921-1955943 GTTTCTGCCCCCCACCAACCAGG + Intronic
1077503565 11:2920019-2920041 ATCACCTGTCCCCACCACCCAGG - Intronic
1078203421 11:9205521-9205543 GTTTCCTCTCCCTACTTCACAGG + Intronic
1080148506 11:29020054-29020076 GTTTCCTTCCCCCACCTCACAGG + Intergenic
1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG + Intronic
1083815423 11:65130030-65130052 GTTTCCCCTTCCCTCCTCCCTGG - Exonic
1084178864 11:67436940-67436962 ATCTCCTCTCCCACCCACCCAGG - Intronic
1084589796 11:70084066-70084088 GTCTCCTCTCCCCCTCCCCCAGG - Intronic
1087064107 11:94011385-94011407 GTTTCCTCACCCTCACACCCAGG - Intergenic
1087671719 11:101114753-101114775 CATTCCTCTCTCCACAACCCTGG + Intronic
1088433472 11:109783950-109783972 GCTTCCCCTCCCCACCTCCTGGG + Intergenic
1089303773 11:117514275-117514297 GCTTCCCCTCCCCACTGCCCTGG + Intronic
1089496165 11:118909688-118909710 GTCCCCTCTGCCCCCCACCCAGG + Intronic
1089519652 11:119055449-119055471 CTCTCCTCTGCCCACCACTCTGG + Intronic
1089698029 11:120227694-120227716 TTTCCCTCTCCCCTCCACACAGG - Intronic
1089831095 11:121328918-121328940 CTTTCCTCTCCCCTCTAACCAGG + Intergenic
1202806994 11_KI270721v1_random:11116-11138 GTTTCTGCCCCCCACCAACCAGG + Intergenic
1091822799 12:3489297-3489319 GTTTCAGCTCCCCTCCTCCCTGG + Intronic
1091866085 12:3838781-3838803 CTTTCGTTTCCCCACCACGCTGG - Intronic
1092736954 12:11592109-11592131 GTCTTCTATGCCCACCACCCAGG - Intergenic
1094484663 12:30915021-30915043 ATTTCCTCTCCCCACCCTCCTGG + Intergenic
1095697026 12:45154923-45154945 TCATCCTCTCCCCCCCACCCCGG - Intergenic
1097017686 12:55998918-55998940 CACTCCTCTCCCCACCACCCCGG + Intronic
1097067052 12:56328354-56328376 CTTTCCTCTCCCCACCAGGCTGG - Exonic
1102570793 12:113825818-113825840 GCTTCCTCTGCCCTCCTCCCAGG + Intronic
1103427897 12:120854195-120854217 GTTTCCTCTGCCCACCTCACAGG - Intronic
1104427283 12:128688042-128688064 GTTTCCTCATCCCATCCCCCAGG - Intronic
1105335072 13:19459882-19459904 GCTGCCTCTCCCCACCTCCCCGG + Intronic
1105859849 13:24399506-24399528 GCTGCCTCTCCCCACCTCCCCGG - Intergenic
1106949690 13:34869687-34869709 GGCTCCCCTCCCCACCCCCCAGG - Intergenic
1107447839 13:40484125-40484147 ATTTCCTCTCCTTACCACCATGG - Intergenic
1108976517 13:56450934-56450956 ATTTCTTCACCCCACCCCCCAGG + Intergenic
1109941453 13:69371920-69371942 GGTTCCACTCCTCACCACCATGG + Intergenic
1112320813 13:98405871-98405893 GTTTCCTCTCCCCGTTGCCCGGG + Intronic
1112783773 13:102929643-102929665 TCCTCCTCTCCCCACCTCCCAGG - Intergenic
1113395728 13:109945742-109945764 GCTTCCTCACACCATCACCCTGG + Intergenic
1113882477 13:113635401-113635423 CCTTCCTCTCCCGGCCACCCTGG - Intronic
1114261335 14:21038784-21038806 GTTTCCTCTTTCCTCCATCCTGG + Intronic
1115641861 14:35340294-35340316 GCTGCCTCCCACCACCACCCGGG + Intergenic
1117058514 14:51936993-51937015 GGTTCTCCTCCCCACAACCCAGG + Intronic
1120827663 14:88970010-88970032 CTCTCCTCCCCCCTCCACCCTGG + Intergenic
1120996372 14:90421376-90421398 GTGTCCCCTCCCCACCACGGCGG + Intergenic
1121469290 14:94139456-94139478 GTCTCCTCTCCCCTCCACTCAGG - Intergenic
1122080084 14:99261064-99261086 GTTTCCTCTCCCCACCACCCAGG + Intronic
1122318361 14:100838774-100838796 GTTTCCTTTCCCAACCACCCAGG - Intergenic
1122959328 14:105087416-105087438 GTTCCCTGTCCCCTCCCCCCAGG + Intergenic
1122973960 14:105163522-105163544 GATTCCTATCCCCACATCCCAGG - Intronic
1124102849 15:26712101-26712123 CTTCCCTCTGCCCACCTCCCTGG - Intronic
1124439252 15:29674963-29674985 GCTTCCCCTCTCCGCCACCCCGG + Intergenic
1126898691 15:53287988-53288010 GTTTCCTCCTCCCACAACACTGG - Intergenic
1126923053 15:53549153-53549175 GTTTCCTCTCCCCAGCACCTTGG - Intronic
1127023414 15:54776130-54776152 CTTTCCTTTCCCCACACCCCAGG + Intergenic
1128064999 15:64759102-64759124 TTGACCTCTCCCCACCTCCCCGG + Intronic
1128360187 15:66956457-66956479 GATGCTCCTCCCCACCACCCTGG - Intergenic
1128767889 15:70262185-70262207 GTTTTCTCTCCCCATCCCCTCGG + Intergenic
1128911431 15:71519143-71519165 GTTTCCTCTGCCCCCAACACTGG - Intronic
1130299228 15:82667322-82667344 GTTTCCAGGCTCCACCACCCAGG + Intronic
1130665697 15:85867950-85867972 GCCTCCTATCCCCACAACCCTGG + Intergenic
1130677828 15:85969317-85969339 GTTTTCTCTCCTCCCCACCATGG + Intergenic
1130812554 15:87395010-87395032 GTTTCCTCTCCCTACCCCCGTGG - Intergenic
1130949749 15:88575993-88576015 GTTTCCTCTCCCAGCCATCAGGG - Intergenic
1131268417 15:90932371-90932393 CTTCCCAGTCCCCACCACCCAGG + Intronic
1131305833 15:91242394-91242416 CTTTCCTCTACCTACCAACCTGG + Intronic
1131884983 15:96902963-96902985 GCTACCTCTCCCCTTCACCCCGG + Intergenic
1133104068 16:3495428-3495450 GTTGCTCCTCCCCACCACACTGG - Intronic
1133770469 16:8864725-8864747 GCTTCCTGCCCCCACCACCCTGG - Intronic
1134313972 16:13101106-13101128 CTTCCCTCTCCCCACAGCCCCGG - Intronic
1134364721 16:13566563-13566585 GTCTCCTTTCCCCTCAACCCTGG - Intergenic
1135041109 16:19117347-19117369 GTCTCCTCTGCCCACGACCAGGG - Exonic
1135052005 16:19200995-19201017 GCTCCGACTCCCCACCACCCAGG + Intronic
1136990882 16:35150840-35150862 GCTCCCTCTCACCACCACCCAGG + Intergenic
1137382286 16:48010579-48010601 GTGTCCTCACCCCAGAACCCAGG + Intergenic
1137390447 16:48076783-48076805 GTTTCCTCTCCCTGCCATCTGGG + Intergenic
1137394979 16:48110616-48110638 ATCTCGTCTCCCCACCTCCCTGG + Intronic
1137422994 16:48352155-48352177 GATTTCTGTCCCCACCTCCCAGG - Exonic
1137982936 16:53085187-53085209 GTCTCCAGTCCCCACCACTCTGG + Intronic
1138013970 16:53412638-53412660 GTCACCTCTCACCAGCACCCCGG - Intergenic
1140533253 16:75684740-75684762 GTATTCCCTCCCCACAACCCTGG - Intronic
1140714434 16:77709132-77709154 GTCTCAGCTCCCCACCTCCCTGG + Intergenic
1140773510 16:78228061-78228083 GCTTCCTCTCCCCATAGCCCTGG - Intronic
1141216021 16:82024567-82024589 GTCTCCTCTCACCACCACCAGGG - Intergenic
1141236995 16:82228122-82228144 GTTCCCTCTCTCCACAACCATGG - Intergenic
1141770489 16:86086992-86087014 GGTTCTTCTTCCCTCCACCCGGG - Intergenic
1142124714 16:88404491-88404513 CCTTCCTCTCCCCACCACGAAGG - Intergenic
1142148963 16:88504409-88504431 GCTCCCTCTCCCCACTTCCCAGG + Intronic
1143636090 17:8164368-8164390 GCTTCCTCCCTCCCCCACCCTGG + Intergenic
1143736663 17:8916139-8916161 GTTCCCTCTCCCCATCTCTCAGG - Intronic
1143768393 17:9152345-9152367 GTTTCCTCTGCCCAGTTCCCCGG + Intronic
1144782284 17:17814166-17814188 GGTTCCTCTCCCCAGCCCCCAGG - Intronic
1145023762 17:19452492-19452514 GTTTCCTATCTCCGCCACTCTGG - Intergenic
1145394410 17:22483379-22483401 GTTTCCTCCCCACAACACCTGGG + Intergenic
1146654252 17:34626079-34626101 GTGGCCTCTCCTGACCACCCTGG + Intronic
1147244324 17:39110291-39110313 CTCTCCCCTTCCCACCACCCTGG - Intronic
1147590857 17:41682579-41682601 GTATCCTCTCCCACCCACCTCGG + Intergenic
1147746180 17:42696003-42696025 ATTTCTTCTCCCCACCCCACAGG + Exonic
1148445899 17:47736943-47736965 TCTTCCTCTCCCACCCACCCTGG + Intronic
1148556284 17:48580727-48580749 GGTTCCTCCCCACACCTCCCCGG - Intronic
1149528882 17:57379311-57379333 GTTTTCCCTCCCGCCCACCCTGG + Intronic
1150271703 17:63870733-63870755 GTTTACTCTCCCAAGCACCTTGG - Intergenic
1150275247 17:63893629-63893651 GTTTGCTCTCCCAAGCACCTTGG - Intergenic
1150277385 17:63908379-63908401 GTTTACTCTCCCAAGCACCTTGG - Intergenic
1150537345 17:66056724-66056746 GTTACCACTCCCCACACCCCAGG - Intronic
1151106353 17:71620716-71620738 CTTTCCTCTCCACCCCTCCCTGG - Intergenic
1151191264 17:72399798-72399820 TTTTCCCCTCCCAGCCACCCTGG + Intergenic
1151627097 17:75283687-75283709 TTTTCCTCGCCCCTCCACCTGGG - Intronic
1151970357 17:77454516-77454538 GGTCCCTCTCGCCCCCACCCAGG + Intronic
1151990061 17:77568877-77568899 ATTTCCCCTCCCCACAACCTTGG - Intergenic
1152624849 17:81383524-81383546 CTTTCCTCCTCCCCCCACCCCGG + Intergenic
1153016086 18:583868-583890 GTTTCCTCCCTCCCCCACCTGGG - Intergenic
1154035414 18:10796761-10796783 GTCTCCTTTCTCCAGCACCCTGG + Intronic
1155555015 18:27009201-27009223 GTTTCATCTCCCCTCCAGCCTGG + Intronic
1155779278 18:29811071-29811093 GTTTCCTCTCCCTTCAACTCAGG - Intergenic
1157308437 18:46534091-46534113 GTTTCTCCTCCCCACCTCCAAGG - Intronic
1157621365 18:49019057-49019079 GGTTCATCTCCTCACCGCCCAGG + Intergenic
1160068894 18:75607185-75607207 GTGCCCTCTCCCCAGGACCCAGG - Intergenic
1160083977 18:75757028-75757050 CTTTCCCCTCCCCACCCCCAAGG - Intergenic
1161257987 19:3320387-3320409 GCTTCGTCTCCCCAGCCCCCTGG + Intergenic
1161461411 19:4400087-4400109 GGTGCCTCTCCCCTCCTCCCAGG + Intronic
1161566313 19:5004767-5004789 GTGGCCTCTGCCCAACACCCAGG - Intronic
1161607829 19:5224634-5224656 CGCTGCTCTCCCCACCACCCTGG - Intronic
1161853335 19:6750270-6750292 TTTTCCTGTCCCCTCCTCCCAGG + Exonic
1163179915 19:15592027-15592049 GTTTCCTGGCACCACCAGCCTGG - Intergenic
1163204671 19:15794016-15794038 CTTTCCTCTCTCCACCAACTAGG + Exonic
1163275838 19:16283721-16283743 GCTTCCTCTCTCCAACACGCAGG - Intergenic
1164545842 19:29162020-29162042 CTTTCCTCTCACCAACCCCCTGG + Intergenic
1164617873 19:29677460-29677482 ATGTCCTCTCCCCACCAGGCAGG - Intergenic
1165434188 19:35787657-35787679 GCTTCTTCTCCCCAGCCCCCAGG + Exonic
1166314479 19:41981368-41981390 TGTTCCTCTCCCCACCAGGCGGG + Intronic
1166409006 19:42543799-42543821 GTCTCCTCATCCCACCACTCAGG - Intronic
1166675597 19:44738868-44738890 GCTTCCCCTCCCCACCTCCCTGG + Intergenic
1167100018 19:47399012-47399034 GGGTCCTCACCCCACGACCCAGG + Intergenic
1167146809 19:47685914-47685936 TTTTCCTTGACCCACCACCCGGG + Intronic
1167372500 19:49091832-49091854 GTTTTCCCTCGCCACCAACCTGG + Intronic
1168103961 19:54155551-54155573 TTTTCCTCTCAGCCCCACCCTGG + Exonic
1168413348 19:56153728-56153750 GCTGCCTCTCCCCACCTCCCAGG - Intronic
1202669804 1_KI270709v1_random:40216-40238 GTTTTTTCCCCCCACCACCGCGG + Intergenic
1202714296 1_KI270714v1_random:33767-33789 GTCTCCCCTCCGCACCGCCCGGG + Intergenic
925038229 2:708716-708738 CTGGCCTCTCCCCATCACCCTGG - Intergenic
925402763 2:3587327-3587349 GTTTGTTCTCCCCACCCCTCGGG - Intergenic
927671483 2:25072239-25072261 GTTCTCTTTCCCCACCACCCTGG + Intronic
928072675 2:28233184-28233206 GCTTCCTCCCCGCACCACTCTGG + Intronic
929680955 2:43993292-43993314 GTTTATTGTTCCCACCACCCAGG + Intronic
929808453 2:45169156-45169178 GTTTCCCCGCGCCACCAGCCAGG - Intergenic
929945617 2:46369548-46369570 ACTCCCTCTCCCCACCACCCCGG - Intronic
929961233 2:46497802-46497824 CTTCCCTCTCCTCACCAGCCAGG - Intronic
931320697 2:61172383-61172405 GTTTGCTTTCCCCATCACCTGGG - Intergenic
932278661 2:70471183-70471205 CTGTCCTGCCCCCACCACCCAGG + Intronic
932406007 2:71513064-71513086 GTTCCTTCTCACCACCTCCCAGG - Intronic
934037991 2:88104629-88104651 TTTTCCACTCCCCGCCACCTCGG + Intronic
934591004 2:95550298-95550320 TTTTCTTCCCCCCACCTCCCTGG + Intergenic
937665772 2:124485273-124485295 GTTCTCTCTGCCCACCTCCCAGG + Intronic
937909401 2:127068294-127068316 TTTCTCTCTCCCCACCTCCCTGG - Intronic
939569333 2:143821907-143821929 TCTTTCTCTCCCTACCACCCTGG - Intergenic
940495746 2:154426132-154426154 GATTCCTCTTCCAACCTCCCTGG + Intronic
940869653 2:158849338-158849360 TTATCCTCTCCCCACTCCCCTGG + Intronic
940908177 2:159187109-159187131 GCGTCCTCTCACCACCACCCAGG - Intronic
941095926 2:161239100-161239122 GGGTCCTCGCCCCACCGCCCCGG - Intergenic
941115510 2:161467526-161467548 TTTTCCCCTCCCCAACGCCCTGG + Intronic
941917054 2:170819946-170819968 GCTCCCTCTTCCCGCCACCCAGG + Intronic
942968893 2:181932737-181932759 GTTTCCTCTTCCCACTTCCTAGG - Intergenic
943643776 2:190386696-190386718 CTTCCCTCTCCCCCTCACCCTGG + Intergenic
944434344 2:199671110-199671132 GTTTCCTCTTCCCACTTCCCGGG - Intergenic
944840092 2:203616412-203616434 ATTTCCTCTGCCCACGACCGGGG - Intergenic
946554530 2:220840987-220841009 GTCTTCTCTCCCCACCTCCTGGG + Intergenic
947626311 2:231621371-231621393 GTCTCCTTTCCCCAGCATCCGGG + Intergenic
947873663 2:233453808-233453830 GTTTCTTCTCCCCACCCAGCTGG - Intronic
947998080 2:234545109-234545131 GTTTCTTCTCTTCACCACCAGGG - Intergenic
948210366 2:236188537-236188559 GTTTCCCCTCCCCCCAGCCCTGG - Intergenic
948237647 2:236402510-236402532 GAGTCCTCTCCCGAGCACCCCGG - Intronic
948567212 2:238894676-238894698 GATCCCTCTCCCCACCTTCCTGG + Intronic
948831234 2:240599223-240599245 GTTGGCTCTGCCCACCTCCCAGG - Intronic
948927749 2:241110422-241110444 GCGTCCTCTCCCCATCTCCCTGG - Intronic
948975085 2:241459030-241459052 GTTGCCTCTCCTCAACACCTGGG + Intronic
948981095 2:241495261-241495283 GTTGCCTCTCCCCACCTCATGGG + Exonic
1168931423 20:1627364-1627386 CTTTCCCCTCCACACCCCCCAGG - Intergenic
1169343742 20:4814493-4814515 GTTTCCTCTACTCGCCACCTGGG + Intronic
1169404814 20:5314611-5314633 GTCTCCTCTCCCCGCATCCCGGG - Intergenic
1171031530 20:21681300-21681322 GTTTCCTCTCTTGACCTCCCAGG - Intergenic
1172022435 20:31924137-31924159 CATTCCTCTCACCTCCACCCCGG + Intronic
1172605467 20:36210693-36210715 GTTTGCTTTCCTGACCACCCTGG + Intronic
1172701328 20:36855341-36855363 GTGCTCTCTCCCAACCACCCTGG + Intronic
1173319908 20:41978070-41978092 GTTTACTCTCCCCTCCCCTCTGG - Intergenic
1173576241 20:44114699-44114721 GGTCCCTCCTCCCACCACCCTGG + Intronic
1173911775 20:46675869-46675891 GTTCCCCCTCCTGACCACCCTGG - Intronic
1174200158 20:48801595-48801617 CTCTCCTCCCACCACCACCCTGG + Intronic
1174317681 20:49715013-49715035 GTATCCTATCCCCATCACCTGGG + Intergenic
1174746794 20:53071743-53071765 TTTTCCTCTCCCCTGCATCCAGG + Intronic
1175890261 20:62312847-62312869 ATCTCCTCTCCCTGCCACCCTGG + Intronic
1176389992 21:6158466-6158488 CTTTCCTGCTCCCACCACCCAGG + Intergenic
1176738508 21:10575110-10575132 GCTGCCTCTCGCCACCTCCCCGG - Intronic
1179503063 21:41821856-41821878 CCTTCCTCTCCAGACCACCCAGG + Intronic
1179634449 21:42698461-42698483 GTATTCTCTCCCCATCACGCTGG + Intronic
1179767620 21:43584849-43584871 GTCTCCTATCCCCCACACCCTGG + Intronic
1180622607 22:17171868-17171890 GTTTCCTGTCCCTTCCTCCCTGG - Intergenic
1181312376 22:21952392-21952414 TTGGCCTCTCCCCACCCCCCAGG - Intronic
1181643072 22:24214987-24215009 TTTTCCTCTCCCCGACACACAGG + Intergenic
1181648498 22:24246462-24246484 CCCTCCTCTCCCCACCATCCTGG + Intergenic
1182327909 22:29528229-29528251 CTTCCCTCTCCCAACCAGCCAGG + Intronic
1182453925 22:30437697-30437719 TATTCCTCTACCCGCCACCCCGG - Intergenic
1182784222 22:32893207-32893229 GTTTGCTCTGCCCCCCTCCCAGG + Intronic
1183131040 22:35836366-35836388 TTCTCTTCTCCCAACCACCCAGG + Intronic
1183302029 22:37063205-37063227 GCTGCCTCTCCCCGCCCCCCAGG - Exonic
1183362495 22:37389958-37389980 GGTTCCTCACCCCACCAGCTTGG - Intronic
1183370838 22:37431320-37431342 TTCTCCTCTCCCCACCACCATGG + Intergenic
1183525073 22:38317751-38317773 GTCTCCTCTCCCCGCCTGCCAGG + Intronic
949648978 3:6132865-6132887 GTTTCCTCTTCCCATCACTTTGG + Intergenic
949954432 3:9256012-9256034 GTTTGTTCTCCCATCCACCCAGG + Intronic
950129443 3:10531977-10531999 TTCTCCCCGCCCCACCACCCTGG + Intronic
954448483 3:50559207-50559229 GTTTCCTCTCCCCACCCCAGAGG + Exonic
955399039 3:58578080-58578102 ATGTCATCTCCCAACCACCCTGG - Intronic
959771758 3:110107307-110107329 GTTTCCTATCCTCACCCCTCTGG - Intergenic
960521532 3:118660735-118660757 GTTCCCTTCACCCACCACCCTGG - Intergenic
961509186 3:127390785-127390807 GTCCCCACTCCCCACCTCCCTGG - Intergenic
961692381 3:128679463-128679485 CCTTCCACTCCACACCACCCAGG + Intronic
966914437 3:184577176-184577198 GTGTCCCCTCCTCACCAGCCTGG - Exonic
967200958 3:187072145-187072167 ATGGCCTCTCCCCACCACACTGG - Intronic
967328068 3:188262098-188262120 GTGTCCTCTTCCCACCAGCCTGG - Intronic
967365998 3:188687238-188687260 ATTTCCTCTCTCCCCCACCCTGG + Intronic
968040476 3:195584719-195584741 GTCCACACTCCCCACCACCCCGG - Intergenic
968728504 4:2259198-2259220 GTCTCCTGTCCCAACCACTCAGG + Intronic
968745147 4:2356138-2356160 GTTTGCTCTCCCCACCCCAGGGG - Intronic
968817098 4:2827864-2827886 ATTTCCTCCTCCCACCTCCCAGG + Intronic
969432079 4:7161260-7161282 ATTTACTGCCCCCACCACCCAGG - Intergenic
970004354 4:11396428-11396450 GTCTCCTGTCCAGACCACCCCGG - Exonic
970515427 4:16824840-16824862 CTTTCCTATCCCCAGCAACCAGG - Intronic
973560409 4:52129918-52129940 TTTTCCTCTGGCCAGCACCCAGG + Intergenic
977046044 4:92070431-92070453 ATTTCCCCTCCACATCACCCTGG - Intergenic
978501278 4:109412372-109412394 GTTTCCTCTCCCCTGTACCTAGG + Intergenic
985251721 4:188031244-188031266 GTTCCCTTTCCCTATCACCCTGG - Intergenic
986264624 5:6181303-6181325 CTTTCCTCTCTCCAACTCCCTGG + Intergenic
987081988 5:14433544-14433566 TTTTCCTTTCGCCACCTCCCTGG - Intronic
988022827 5:25645170-25645192 GTTTTCTCGCTCCGCCACCCAGG - Intergenic
992191470 5:74296146-74296168 GTTTCCATTCCACACCACCAAGG + Intergenic
992399988 5:76403266-76403288 GTTTCCTTTCTCCTCCAGCCAGG - Exonic
992507576 5:77403268-77403290 TTTGCCTGCCCCCACCACCCTGG + Intronic
993027145 5:82660310-82660332 GCTTCCTCTCCCAACGACTCTGG - Intergenic
994942040 5:106336486-106336508 TTCTCCTTTCCCCACTACCCAGG + Intergenic
997207619 5:132059395-132059417 CTCTCCTCTCCCTCCCACCCGGG + Intergenic
997263179 5:132479091-132479113 GTTTCCCAGCCCCACCAACCAGG + Intergenic
997467175 5:134096125-134096147 GTTTCCTTTCCCCAGGGCCCGGG + Intergenic
997594775 5:135099799-135099821 GATCCCTCTCCCCACCTTCCAGG + Intronic
997684109 5:135776726-135776748 ATTTTCTTTCCCCACCCCCCGGG - Intergenic
997684751 5:135780784-135780806 TCATCCTCTCCCCACCTCCCCGG - Intergenic
997950988 5:138242280-138242302 CTATCCTCTCCCCTCCACCACGG - Intergenic
998953038 5:147411261-147411283 GTTTCCTCTCACCATGACCAAGG - Intronic
999179240 5:149657269-149657291 GTCTCCTCTCCCCACTGCCTTGG + Intergenic
1001277115 5:170359063-170359085 GTTCCCTTTCCCCATAACCCAGG - Intronic
1001398444 5:171432979-171433001 CTTTCCTAGCCCCACCTCCCAGG - Intronic
1001476580 5:172054894-172054916 GTGTCATGTCCCCACCAGCCTGG - Intronic
1001810159 5:174621530-174621552 GTTTTCTCTCCACAGGACCCTGG - Intergenic
1001942513 5:175750714-175750736 GGTACCGCTCCCCAGCACCCCGG + Intergenic
1002189748 5:177472461-177472483 GTTTCCTTTTTCCACCACCCTGG + Intronic
1006114822 6:31769955-31769977 GTTTCCTGGCCCCACCACCAGGG - Intronic
1006359720 6:33580356-33580378 CTTTCCCCACCCCACCTCCCAGG + Intergenic
1006523091 6:34583436-34583458 GTTGCCTCTGCCCTCCACCCAGG - Intergenic
1007029066 6:38610911-38610933 GTTTAGTCCCCCCCCCACCCCGG - Intronic
1008393159 6:50976473-50976495 GTTTCTTCTCCCCATCTTCCAGG + Intergenic
1008922583 6:56858180-56858202 CCTTCCTCTCACCTCCACCCAGG - Intronic
1009767797 6:68104071-68104093 GTCTCCTTTCCCCAGAACCCAGG - Intergenic
1011635898 6:89372851-89372873 GTTAGCTCTCCCCACCTCCGTGG + Intronic
1018552043 6:165008651-165008673 ATCTCCTCTCCCCTTCACCCTGG - Intergenic
1018560079 6:165092950-165092972 CTGTCCTCTCCCCACCTCCATGG - Intergenic
1019078697 6:169412495-169412517 GTCTCCTCTTCCCCCCACCTGGG + Intergenic
1019571625 7:1715512-1715534 CTTTCCCCTCCCCAGCACCTGGG + Intronic
1019573593 7:1725331-1725353 CTCTCCTCTCCACACCACCAGGG - Intronic
1020403595 7:7805253-7805275 GATACCTGGCCCCACCACCCTGG + Intronic
1020530553 7:9328726-9328748 GTTTCCTTTCCCCACCCCAGTGG + Intergenic
1022754215 7:33268121-33268143 ATTTCCTGTGCCCACCAGCCAGG - Intronic
1023984237 7:45085834-45085856 GGCTCCTCTCCCGGCCACCCTGG - Exonic
1024002457 7:45199713-45199735 TCTTCCTCTCCACACCGCCCTGG + Intergenic
1025021201 7:55481467-55481489 CTTTTCTCTCGACACCACCCTGG - Intronic
1026621093 7:71950533-71950555 TGATCCTCTCCCCACCACTCTGG + Intronic
1027389163 7:77688463-77688485 GTTTCCTCTCCTCTTCACCCAGG + Intergenic
1028352512 7:89866254-89866276 GATTCCACACCCCCCCACCCCGG - Intergenic
1029733125 7:102450727-102450749 GTTTCCTCTCCCGGCCACCATGG - Exonic
1029887841 7:103891649-103891671 GTTTCAACTCCCCACCATCCTGG + Intronic
1033597857 7:142869283-142869305 CTTTCATCTCCCCATCACACAGG - Intronic
1034244556 7:149634706-149634728 GTGTCCTGTGCCCAGCACCCAGG - Intergenic
1035352601 7:158257149-158257171 GTATCCTCTGTCTACCACCCAGG + Intronic
1036709130 8:11067137-11067159 TTCTCCCCTCCCCACCAGCCTGG - Intronic
1036768975 8:11565928-11565950 GTTTCCTCCTTCCAGCACCCCGG - Intergenic
1037890980 8:22623557-22623579 CTTTCTTCTCGGCACCACCCTGG + Intronic
1039405917 8:37312390-37312412 CTTTGGTCTCCCCACCATCCTGG + Intergenic
1040106748 8:43546053-43546075 GCGTCCTGTCCCCATCACCCGGG + Intergenic
1040107649 8:43549569-43549591 GTGTCCTGTCCCCATCATCCAGG + Intergenic
1040107827 8:43550230-43550252 GAGTCCTGTCCCCATCACCCAGG + Intergenic
1040110166 8:43563704-43563726 GGGTCCTGTCCCCATCACCCAGG + Intergenic
1040110795 8:43566487-43566509 GCGTCCTGTCCCCATCACCCGGG + Intergenic
1040757920 8:50803183-50803205 GTTTTCTATCTCCACCACCTTGG + Intergenic
1042819260 8:72912252-72912274 TTTTCCACTCCCCACAACACAGG - Intronic
1043633815 8:82367157-82367179 TCATCCTCTCCCCCCCACCCCGG - Intergenic
1044561867 8:93620122-93620144 GTTTCTTCCCCTCCCCACCCTGG + Intergenic
1045538208 8:103055338-103055360 GTTGTCTCTCCCCACACCCCTGG + Intronic
1045737892 8:105318377-105318399 GTCTCCCCTCCCCACAGCCCCGG + Intronic
1047192373 8:122689835-122689857 TTTTCCACTCCCCAACACTCAGG + Intergenic
1048380428 8:133860520-133860542 TCTTCCTCTCCCCATCAACCTGG + Intergenic
1048414122 8:134207588-134207610 TTTTCCTTTCCCCATCACACAGG + Intergenic
1048808182 8:138260522-138260544 TTTTCTTCTCCCAACTACCCTGG + Intronic
1049071250 8:140357616-140357638 GTTTGCTCTCCCCAGCCCCTGGG - Intronic
1049361517 8:142214374-142214396 ACCTCCTCTCCCCGCCACCCCGG + Intronic
1049787177 8:144456543-144456565 GCCACCTCTCCCCACCAGCCAGG + Intronic
1049997325 9:1045515-1045537 GTCTCCACTCCCCACCCCCATGG + Intergenic
1054793365 9:69276377-69276399 GTTTCCTCTCCTCTTCAACCTGG - Intergenic
1054848409 9:69821056-69821078 CTTTCCTCCCCGCAGCACCCGGG - Intronic
1054850455 9:69842068-69842090 GTTTCATCTCTCCAGCACTCTGG - Intronic
1056198261 9:84249600-84249622 ATCTCCACTCCCCACCCCCCTGG - Intergenic
1056233439 9:84569631-84569653 GTGTGCCCTCCCCACCATCCTGG - Intergenic
1056691914 9:88815019-88815041 CTTTCCCCTCCTAACCACCCTGG + Intergenic
1056754580 9:89373716-89373738 GTGTCCTCCCCCAGCCACCCAGG - Intronic
1057219457 9:93248144-93248166 GTCTGCTGGCCCCACCACCCTGG - Intronic
1057371749 9:94480021-94480043 GACACCTCCCCCCACCACCCAGG - Intergenic
1057537055 9:95920689-95920711 CTTTGCTCTCCACCCCACCCTGG - Intronic
1057739176 9:97697073-97697095 CTTCCCTCTCCCCGCCTCCCCGG - Intronic
1058360472 9:104140657-104140679 ATTTCCTCTCCCCTCCACAGTGG - Exonic
1059760419 9:117332056-117332078 GTGTCAGCTCCCCACCACCAAGG + Intronic
1059762057 9:117347361-117347383 ATTTGCTCTCACCACCACCTGGG + Intronic
1059770072 9:117415642-117415664 CCTTCCTCTCCCCTCCATCCAGG + Intergenic
1060059688 9:120448045-120448067 GTATCGTCTCCCTGCCACCCAGG - Exonic
1060727309 9:126015019-126015041 GTTTCCTCTCCCCAGCTCCCTGG - Intergenic
1060907180 9:127317128-127317150 GTCTCCCGTCCACACCACCCAGG - Intronic
1061181870 9:129029252-129029274 GCTTTCTCCTCCCACCACCCAGG + Intergenic
1061612227 9:131754763-131754785 GTCTCCTCCCCCCAGAACCCTGG + Intergenic
1061628244 9:131855166-131855188 GTTTCCTCTCCCTGTCCCCCTGG + Intergenic
1061942763 9:133892033-133892055 CTTTCGTCTCCCCACACCCCTGG - Intronic
1062255592 9:135619263-135619285 GTGCCCCCTCCTCACCACCCTGG - Intergenic
1062633143 9:137476052-137476074 ATTTTCTTTCACCACCACCCTGG - Intronic
1062643099 9:137532010-137532032 CTTTCCTCTCCCGAACAGCCAGG + Intronic
1186588235 X:10899898-10899920 TTGTCCTCTCCCCACTACCCTGG - Intergenic
1186837266 X:13450351-13450373 GTTTCCTCTCCCCAGAGGCCAGG + Intergenic
1189191776 X:39115235-39115257 GTTTCCTCTCCCTTCCATGCAGG - Intergenic
1190991131 X:55551816-55551838 GGCTCCTCTCCCCACAACCAAGG + Intergenic
1194871856 X:99142070-99142092 CTTCCCTTTCCCCACCACCATGG - Intergenic
1195614870 X:106904066-106904088 TTTGCCTCTCCCCAGCACCCTGG - Intronic
1196051025 X:111304434-111304456 TTTTCCTCTCCCCAGCTCCATGG + Intronic
1197884103 X:131200185-131200207 GTTTCCTCCCCGCCCCACCAGGG - Intergenic
1198089916 X:133318427-133318449 TTTGCATCTCCCCACCTCCCAGG - Intronic
1199525417 X:148786200-148786222 GTTGCCTCCCCACCCCACCCTGG + Intronic
1199767956 X:150954167-150954189 AATGCCTCTCCCCACCCCCCAGG - Intergenic
1199846227 X:151694749-151694771 GCGTCCTGTCCCCACCCCCCGGG - Intergenic
1200329461 X:155281202-155281224 CTTTCCTCCCCCCACTGCCCCGG - Intronic