ID: 1122080086

View in Genome Browser
Species Human (GRCh38)
Location 14:99261070-99261092
Sequence TCTCCCCACCACCCAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 8, 3: 86, 4: 830}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122080077_1122080086 23 Left 1122080077 14:99261024-99261046 CCTGAGATGACAGGGTGTTCACC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080081_1122080086 2 Left 1122080081 14:99261045-99261067 CCCGATTCCAAAGAACGGGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080083_1122080086 -5 Left 1122080083 14:99261052-99261074 CCAAAGAACGGGGTTTCCTCTCC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080082_1122080086 1 Left 1122080082 14:99261046-99261068 CCGATTCCAAAGAACGGGGTTTC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080075_1122080086 25 Left 1122080075 14:99261022-99261044 CCCCTGAGATGACAGGGTGTTCA 0: 1
1: 1
2: 0
3: 8
4: 123
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830
1122080076_1122080086 24 Left 1122080076 14:99261023-99261045 CCCTGAGATGACAGGGTGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG 0: 1
1: 0
2: 8
3: 86
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122080086 Original CRISPR TCTCCCCACCACCCAGGCTG TGG Intronic
900135070 1:1113386-1113408 TCTTCTCACCACTCTGGCTGAGG - Intronic
900180770 1:1310020-1310042 TGTGCCCTCCCCCCAGGCTGGGG + Intronic
900206132 1:1432646-1432668 TGTCCCCAGCACTGAGGCTGGGG + Intergenic
900268134 1:1770698-1770720 TCTCTCTGTCACCCAGGCTGGGG - Intronic
900428910 1:2592802-2592824 TGCCACCAGCACCCAGGCTGCGG - Intronic
900498054 1:2985338-2985360 TCTCACCAGCACTCAGGGTGGGG - Intergenic
900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG + Intronic
900677336 1:3896099-3896121 CCTCCCCAGCTCCCAGGCAGCGG + Intronic
900698023 1:4024392-4024414 CCTCCCCACCAGCCAGGATCAGG - Intergenic
901000094 1:6144717-6144739 CCTCCCACCCACCCAGGCTAAGG + Intronic
901078478 1:6570273-6570295 TCTGCCCATCAACCAGGATGTGG - Intronic
901089143 1:6629846-6629868 TCTCCCCACCAACCAGGCACTGG - Intronic
901755471 1:11438979-11439001 GATGCCCACCACCCCGGCTGGGG - Intergenic
901761328 1:11473635-11473657 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
901765787 1:11499240-11499262 ACTCCCCACAAGGCAGGCTGAGG + Intronic
902191397 1:14765698-14765720 ACTCCCCATCAGCCTGGCTGAGG - Intronic
902240192 1:15083256-15083278 TCCCCCCTCCACCTAGCCTGAGG - Intronic
902422381 1:16291410-16291432 TCACTCCGCCACCCAGGCTGGGG + Intronic
902469405 1:16638142-16638164 TCTCGCCACCACCCAGCCAGGGG + Intergenic
902519846 1:17010015-17010037 TCGCCCCCCCACACAGCCTGTGG - Intronic
902719515 1:18294825-18294847 CCTCCCAACCAGCCATGCTGGGG + Intronic
903010601 1:20327534-20327556 TCTCCCCACCTCTCAGGATCAGG + Intronic
903703819 1:25270313-25270335 GGTCCCCAACCCCCAGGCTGTGG + Intronic
903723424 1:25423011-25423033 GGTCCCCAACCCCCAGGCTGTGG - Intronic
903866251 1:26400488-26400510 TCTCCCCACCAAACAGACAGGGG + Intergenic
903923030 1:26814649-26814671 TCTTCACATCACCCAGCCTGTGG + Intergenic
903947708 1:26974001-26974023 TCCCCCCACCACCCAGGGGTGGG - Intergenic
904038426 1:27570983-27571005 TCTCCCATCCCCCCAGCCTGGGG + Intronic
904039381 1:27575464-27575486 TCCCCCCACCACCCTCGCCGCGG + Intronic
904205819 1:28854682-28854704 TCACCCTGTCACCCAGGCTGGGG + Intronic
904390561 1:30182873-30182895 CATCACCACCACCAAGGCTGAGG - Intergenic
904676087 1:32200023-32200045 CCTCCCCACCCCCCAGGCCTAGG - Intergenic
904736045 1:32634557-32634579 TCTCTCTGTCACCCAGGCTGGGG + Intronic
905189700 1:36224202-36224224 TCTCCAGGCCACCCAGGCGGGGG + Intergenic
905309223 1:37037879-37037901 TCTACCCACCAGCCAGGCCTAGG + Intergenic
905389327 1:37626162-37626184 TCTTCTCACCTGCCAGGCTGAGG - Intronic
905476440 1:38232015-38232037 ACTCTAGACCACCCAGGCTGTGG - Intergenic
905973995 1:42162511-42162533 TCTCCAAACCACCAAGGCAGCGG - Intergenic
906700016 1:47850837-47850859 TCTCCCAACCCCCGAGTCTGTGG - Intronic
907104098 1:51864916-51864938 TCACTCCATCACCCAGGGTGGGG - Intronic
907389564 1:54149376-54149398 TCTCCACACCTCCCAGAATGGGG + Intronic
907389931 1:54151596-54151618 TCCTCCCACCACCCAGGCATGGG + Intronic
907936341 1:59045627-59045649 TCTCCTCCACACCCATGCTGGGG + Intergenic
908127774 1:61048209-61048231 TCTCTCTGTCACCCAGGCTGGGG - Intronic
908194492 1:61735573-61735595 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
910261018 1:85294055-85294077 TCTCCCTATCCCCCAGTCTGTGG - Intergenic
910923613 1:92375797-92375819 TCACCCTGTCACCCAGGCTGGGG - Intronic
912216420 1:107618201-107618223 TGTCCCCAACCCCCAGACTGTGG - Intronic
912253509 1:108035404-108035426 TCTCCCTGTCACCCAGGCTGGGG + Intergenic
912410929 1:109480294-109480316 TCCTCCCACCCACCAGGCTGGGG + Exonic
912877924 1:113381123-113381145 TCTCCCCACCCCCCAGACTTTGG + Intergenic
913592352 1:120341508-120341530 TCCCCCCACCCCCAAGTCTGGGG - Intergenic
913651007 1:120913637-120913659 TCCCCCCACCCCCAAGTCTGGGG + Intergenic
914170107 1:145215430-145215452 TCCCCCCACCCCCAAGTCTGGGG - Intergenic
914525224 1:148459393-148459415 TCCCCCCACCCCCAAGTCTGGGG - Intergenic
914598452 1:149176437-149176459 TCCCCCCACCCCCAAGTCTGGGG + Intergenic
914754817 1:150556763-150556785 AGGCCCCACCACCCAGCCTGTGG + Exonic
915242293 1:154532177-154532199 TCTCCCCACCACCCCGCCATGGG - Intronic
915460734 1:156069211-156069233 TCGCTCCGTCACCCAGGCTGGGG + Intronic
915502161 1:156327012-156327034 TCACTCTATCACCCAGGCTGGGG - Intronic
915530628 1:156500477-156500499 TCTACTCACCAGCCCGGCTGGGG + Exonic
915973161 1:160367853-160367875 ACTCCCCACCCCCCATGCTGGGG - Intronic
917194341 1:172449973-172449995 TCTCCACTCCAGCCAGGCTGGGG - Intronic
917491792 1:175504532-175504554 TCTCCCCCTCACTCTGGCTGTGG + Intronic
917841654 1:178985089-178985111 TCTCTCTTTCACCCAGGCTGGGG + Intergenic
919233993 1:194814168-194814190 TCGCTCCATCGCCCAGGCTGGGG + Intergenic
919243687 1:194949335-194949357 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
919558256 1:199088278-199088300 TCTGTCAACAACCCAGGCTGGGG + Intergenic
919621607 1:199870005-199870027 TCCCTCTATCACCCAGGCTGGGG + Intergenic
919747482 1:201017671-201017693 TCTCCCCACCACACCGGCCCTGG + Intronic
920040662 1:203093573-203093595 TCACTCTGCCACCCAGGCTGGGG - Intronic
920085331 1:203411398-203411420 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
920843794 1:209576831-209576853 TCTCCCCACCAGTCAGCCAGCGG + Intergenic
921178833 1:212615819-212615841 TTGCTCCATCACCCAGGCTGGGG + Intronic
922275185 1:224071016-224071038 TCACTCCATCAACCAGGCTGGGG + Intergenic
922286761 1:224177084-224177106 TCACTCTATCACCCAGGCTGGGG - Intronic
922423646 1:225475311-225475333 TCCCCACACCAGCCCGGCTGCGG + Intergenic
922526536 1:226308795-226308817 TCTTCCCTCCACCTCGGCTGGGG + Intronic
922781379 1:228255793-228255815 GGTCCCCAACCCCCAGGCTGTGG + Intronic
922783645 1:228272532-228272554 TGTCCCTACCACCCAGACAGGGG - Intronic
923083632 1:230684288-230684310 TCTGCCTTCCTCCCAGGCTGAGG + Intronic
923571650 1:235120836-235120858 TCACCCTGTCACCCAGGCTGGGG - Intronic
924105272 1:240643185-240643207 TTTTACCATCACCCAGGCTGGGG - Intergenic
924230160 1:241956180-241956202 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
924407049 1:243758867-243758889 TGTCCCCAACCCCCAGCCTGTGG - Intronic
924408490 1:243777400-243777422 GGTCCCCAACACCCATGCTGTGG - Intronic
924615661 1:245609568-245609590 CCTCCCCACCTCAGAGGCTGGGG + Intronic
924860912 1:247921323-247921345 ACTCTCCACCACCCAGTGTGGGG - Exonic
924874286 1:248084268-248084290 ACTCTCCACCACCCAGTGTGGGG + Intronic
924890515 1:248273487-248273509 ACTCTCCACCACCCAGTGTGGGG + Exonic
924892167 1:248295251-248295273 ACTCTCCACCACCCAGTGTGGGG + Exonic
1062829578 10:596793-596815 GCTCCCCACCACCCCAGCTCAGG - Intronic
1062929784 10:1345129-1345151 CATCCTCACCCCCCAGGCTGCGG - Intronic
1063506732 10:6606644-6606666 TCGCTCTGCCACCCAGGCTGGGG + Intergenic
1063587942 10:7369889-7369911 TCACTCTATCACCCAGGCTGGGG + Intronic
1063642414 10:7843147-7843169 TTTCCCTGTCACCCAGGCTGGGG + Intronic
1064087757 10:12358191-12358213 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1064327011 10:14360721-14360743 TATCACCACCACCACGGCTGGGG + Intronic
1064409431 10:15092411-15092433 TCACTCTATCACCCAGGCTGGGG + Intergenic
1064984019 10:21192221-21192243 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1065140297 10:22713851-22713873 ACTTCCTACCTCCCAGGCTGCGG + Intronic
1065553232 10:26889351-26889373 TCACTCTGCCACCCAGGCTGCGG - Intergenic
1066315680 10:34243776-34243798 TCGCCCTGTCACCCAGGCTGGGG - Intronic
1066564011 10:36700853-36700875 TCACTCTACCTCCCAGGCTGGGG - Intergenic
1066581594 10:36887704-36887726 TCACTCTGCCACCCAGGCTGGGG - Intergenic
1066629659 10:37446695-37446717 TATCACCACCACCATGGCTGGGG - Intergenic
1066994493 10:42551832-42551854 TCCCACCATCACCCAGCCTGTGG + Intergenic
1067372259 10:45695938-45695960 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1067418609 10:46127065-46127087 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1067476723 10:46572366-46572388 TCTCCCCATCTCCCATGGTGAGG + Intergenic
1067503960 10:46833641-46833663 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1067514392 10:46925099-46925121 TCACCAAACAACCCAGGCTGGGG - Intronic
1067590631 10:47506360-47506382 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1067618014 10:47769414-47769436 TCTCCCCATCTCCCATGGTGAGG - Intergenic
1067637749 10:48014462-48014484 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1067647867 10:48126710-48126732 TCACCAAACAACCCAGGCTGGGG + Intergenic
1067772696 10:49138776-49138798 TCTCCCCACAGCCCAGATTGGGG - Intergenic
1067875743 10:50005886-50005908 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1067937250 10:50623236-50623258 TCACACCGCCACCTAGGCTGTGG + Intronic
1068970924 10:62957241-62957263 GGTCCCCATCCCCCAGGCTGAGG - Intergenic
1068985074 10:63100468-63100490 TCACTCCATCACCCAGGCTTGGG - Intergenic
1070134348 10:73678883-73678905 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1070211332 10:74325885-74325907 TCTCTCTGTCACCCAGGCTGAGG + Intronic
1070238992 10:74659184-74659206 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1070621360 10:78014123-78014145 TCGCTCTATCACCCAGGCTGGGG - Intronic
1070764516 10:79048669-79048691 CTTCCCCACCATCCAGGGTGGGG - Intergenic
1070926898 10:80229675-80229697 TCCCTCCGTCACCCAGGCTGGGG - Intergenic
1071251407 10:83823377-83823399 CCTCCTCACCATGCAGGCTGAGG - Intergenic
1071501912 10:86210270-86210292 TCTTCCCACCACCCCTGGTGAGG - Intronic
1071607371 10:87005526-87005548 TCTCTCTGTCACCCAGGCTGCGG - Intergenic
1071732791 10:88265961-88265983 TCTCCCCAGCAGCCAGCATGAGG + Intergenic
1071961675 10:90813488-90813510 TCACTCCATGACCCAGGCTGGGG - Intronic
1072227792 10:93386536-93386558 TCTCTCCACCCCCCAGCCTCAGG - Intronic
1072521931 10:96236792-96236814 TCGCCCTGTCACCCAGGCTGGGG - Intronic
1073329492 10:102661208-102661230 TCTCCCTACCCCACAGACTGGGG + Intergenic
1073346753 10:102788787-102788809 TATCCCCCCCAGCCAGGTTGTGG - Intronic
1074587421 10:114781470-114781492 TCACTCCATCACCCAGGCTGGGG - Intergenic
1075568469 10:123521288-123521310 TCTCCCCACCACCCAGCAGGAGG - Intergenic
1075997867 10:126892976-126892998 TCTCCACCCACCCCAGGCTGAGG - Intergenic
1076394949 10:130131522-130131544 TCGCTCTGCCACCCAGGCTGGGG - Intergenic
1076457947 10:130615864-130615886 GCTGCCCAGCACCCAGGCTGTGG - Intergenic
1076731396 10:132440779-132440801 TCTCCCCAGCACACAGGATCTGG + Intergenic
1076731404 10:132440810-132440832 TCTCCCCAGCACACAGGATCTGG + Intergenic
1077003011 11:334424-334446 TCTCCCCTCCCCACAGGCTGAGG + Intergenic
1077119596 11:900722-900744 TCTCCTCCCCACACAGGCTGTGG - Intronic
1077143742 11:1035875-1035897 TCTCCCCAGGTCTCAGGCTGCGG + Intronic
1077298283 11:1836057-1836079 GCTCCCCACCACCCAGGGCATGG - Intronic
1077503562 11:2920013-2920035 TGTCCCCACCACCCAGGGTCTGG - Intronic
1077605063 11:3604132-3604154 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1077895206 11:6448729-6448751 GCTCCCCATCCCCCAGCCTGGGG - Exonic
1078099589 11:8322048-8322070 GGTCCCCAACCCCCAGGCTGCGG + Intergenic
1079132227 11:17753692-17753714 CCTCCCCACCCCCCACGCCGGGG - Intronic
1079144627 11:17839746-17839768 TCTCCCCACCTCACATCCTGAGG + Intronic
1080244477 11:30164041-30164063 CCACCCCACTACCCAGTCTGTGG - Intergenic
1080668914 11:34358385-34358407 CCTTCCCGCCACCCAGGCTTTGG + Intergenic
1080735899 11:35013258-35013280 TCACTCCGTCACCCAGGCTGGGG - Intronic
1080894797 11:36440227-36440249 CCTCCCCCCCACCTATGCTGGGG + Intronic
1081384396 11:42454249-42454271 TCTCTCTGTCACCCAGGCTGTGG + Intergenic
1081805150 11:45886202-45886224 TCTCCCCAACCTCCGGGCTGCGG + Intronic
1081918408 11:46749421-46749443 TCACCCTGTCACCCAGGCTGGGG - Intronic
1081973640 11:47216959-47216981 TCACCCCAGCACCGTGGCTGTGG + Exonic
1082740881 11:56909627-56909649 TCTACCCCCCACCCAGAATGGGG - Intergenic
1083248879 11:61452070-61452092 TCACTCTGCCACCCAGGCTGGGG + Intronic
1083307536 11:61769093-61769115 TCTCCGCACCACCCACATTGGGG - Intronic
1083335729 11:61920498-61920520 TCCCCTCACCACGCAGGCTGGGG + Intergenic
1083366664 11:62145499-62145521 TGTTCCCACCACCCAGGGAGAGG - Intronic
1083540791 11:63510385-63510407 TCTGCCCACCTCCCAGGCATAGG + Intronic
1083633045 11:64105510-64105532 TGTCCCCTCCACACAGGCTGTGG + Intronic
1083738363 11:64694526-64694548 TCTCCCCACCTCTGAGTCTGAGG + Intronic
1083901012 11:65643486-65643508 TGTCCCCAGCATCCAGTCTGAGG - Intronic
1084157031 11:67318949-67318971 TCTCACTGTCACCCAGGCTGGGG + Intronic
1084204775 11:67585022-67585044 CTTCCCCTCCTCCCAGGCTGGGG + Intronic
1084688112 11:70709177-70709199 TCACTCTGCCACCCAGGCTGTGG - Intronic
1084755799 11:71237895-71237917 ACACACCACTACCCAGGCTGGGG + Intronic
1084764699 11:71300748-71300770 TCTCCCCATCAGCCAGGCAGTGG + Intergenic
1085015697 11:73172806-73172828 TCACCTCACCACCCAGGCACAGG - Intergenic
1085040913 11:73325823-73325845 TCTCCCCACTCACCAGGCTCTGG - Intronic
1085468849 11:76743836-76743858 TCTCTCCACCCCTCAGGTTGGGG - Intergenic
1085964507 11:81504707-81504729 TCACTCCATCACCCAGGCTGGGG - Intergenic
1086538911 11:87884404-87884426 TTTCCCCATCTCCCAGGCTGAGG - Intergenic
1086955879 11:92934138-92934160 TCTCTCCGTCGCCCAGGCTGGGG - Intergenic
1087519438 11:99212352-99212374 TTCCCCCACAACCCATGCTGGGG - Intronic
1087671721 11:101114759-101114781 TCTCTCCACAACCCTGGCTCAGG + Intronic
1088792202 11:113235855-113235877 TCCCACCAGCAGCCAGGCTGTGG + Intronic
1088909182 11:114177829-114177851 TCACTCCGTCACCCAGGCTGGGG + Intronic
1088931996 11:114361552-114361574 TCACCCTGTCACCCAGGCTGGGG - Intergenic
1089496169 11:118909694-118909716 TCTGCCCCCCACCCAGGCCCAGG + Intronic
1089536697 11:119164943-119164965 TCACTCTATCACCCAGGCTGGGG - Intergenic
1089800764 11:121024631-121024653 TCTACCCATCCCCCACGCTGGGG - Intronic
1089896316 11:121933534-121933556 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
1089905644 11:122035493-122035515 TCTCCCTGCCACCCAGCATGTGG + Intergenic
1090278498 11:125436343-125436365 TCTCCCCAACACGGAGGCTGAGG + Intergenic
1090397475 11:126428676-126428698 TCTCGCTCTCACCCAGGCTGGGG + Intronic
1091181487 11:133608337-133608359 TCTCCAGACCCCCCAAGCTGGGG + Intergenic
1091375640 12:23077-23099 TCTCCCCACCACCCCATCTCAGG - Intergenic
1092057516 12:5520282-5520304 TCTCCCGAGCACTCAGACTGTGG - Intronic
1092263220 12:6963304-6963326 TCTCCCCAGCACCCACTCTCTGG + Intergenic
1092854362 12:12658609-12658631 TCGCTCTATCACCCAGGCTGCGG - Intergenic
1094852069 12:34386752-34386774 TCTCCCCACCACACATGCGTGGG - Intergenic
1094853538 12:34392938-34392960 CCTCCCCACCACACATGCTCAGG + Intergenic
1094854698 12:34397735-34397757 CCTCCCCAACACCCATGCTTGGG + Intergenic
1094856970 12:34407212-34407234 TCTCCTCACCACCCATGCGTGGG + Intergenic
1095989865 12:48027299-48027321 TCACCCCAACCCCCAGGCTCTGG - Intergenic
1096492644 12:52021153-52021175 TCACTCCACCACCCAGATTGTGG + Intergenic
1096626777 12:52900677-52900699 TCTCCTCATCCCCCAGGATGTGG - Exonic
1096801475 12:54113240-54113262 TCCACCCACAACCCAGGCTCAGG - Intergenic
1097653306 12:62330552-62330574 TCACTCTATCACCCAGGCTGGGG - Intronic
1097815405 12:64068365-64068387 TCACTCTGCCACCCAGGCTGGGG + Intronic
1098002058 12:65955151-65955173 TCTCGCTGTCACCCAGGCTGGGG - Intronic
1099037998 12:77614113-77614135 TCCCTCCTTCACCCAGGCTGGGG + Intergenic
1100313323 12:93418330-93418352 TCTCACTATCGCCCAGGCTGGGG - Intronic
1100764021 12:97843554-97843576 TCACCCTGTCACCCAGGCTGGGG - Intergenic
1100793965 12:98160398-98160420 GCCCTCCAACACCCAGGCTGGGG + Intergenic
1100801522 12:98236127-98236149 TCACTCCATCACCCAGGCTGGGG - Intergenic
1101773470 12:107773011-107773033 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1102216598 12:111166048-111166070 TCTCGCTGTCACCCAGGCTGGGG + Intronic
1102500801 12:113351005-113351027 TCACTCTGCCACCCAGGCTGGGG - Intronic
1102644182 12:114393237-114393259 AGTCCCCACCAGCAAGGCTGGGG - Intronic
1102703876 12:114864370-114864392 TCACACTATCACCCAGGCTGGGG - Intergenic
1102732484 12:115124885-115124907 TCGCTCCGTCACCCAGGCTGGGG - Intergenic
1103350135 12:120278252-120278274 GCTCCCCACCTCCCAGACGGGGG + Intergenic
1103547594 12:121713032-121713054 TGTCCCCACCGCCCGGGCCGGGG - Intronic
1103610676 12:122122393-122122415 TCTCTCTGTCACCCAGGCTGAGG + Intronic
1104541072 12:129665171-129665193 GCTCCCCATCAACCAAGCTGGGG - Intronic
1104547437 12:129724917-129724939 TCTCCCCTCCAGCTAGGTTGGGG + Intronic
1104799762 12:131546676-131546698 TCTCCCCACCCCAGAGGCTCTGG + Intergenic
1104834313 12:131777819-131777841 TCTTCCCAGCCCCCAGGCTGTGG - Intronic
1105052059 12:133063585-133063607 TCACCCCATCACCCAGACTCAGG + Intergenic
1105328470 13:19391741-19391763 TCTCACTGTCACCCAGGCTGGGG + Intergenic
1105701857 13:22940291-22940313 TCTCCCCAAGACCCAGGCATGGG + Intergenic
1105854486 13:24362076-24362098 TCTCCCCAAGACCCAGGCACGGG + Intergenic
1105988046 13:25588864-25588886 TCTCCTCGCCACCGAGGGTGTGG + Intronic
1106257732 13:28036942-28036964 TCACTCTACCACGCAGGCTGGGG - Intronic
1106677604 13:31977555-31977577 TCACTCTGCCACCCAGGCTGGGG - Intergenic
1106782625 13:33074693-33074715 TCTGCCCCCCACCCAGGACGAGG - Intergenic
1106924475 13:34599963-34599985 TCTGCACACCACCCAGACTCAGG + Intergenic
1106936730 13:34730427-34730449 TCACCCTGTCACCCAGGCTGGGG - Intergenic
1107272037 13:38631351-38631373 TCACTCCATCACCCAGGCTGGGG + Intergenic
1107354299 13:39549958-39549980 TCTCCCAACCTCCCAGCCTCAGG - Intronic
1107404736 13:40101907-40101929 TTTCTCCACCACCCAGGCACAGG - Intergenic
1107873951 13:44772615-44772637 TCTCTCTATCACCCAGGCTGGGG + Intergenic
1108377362 13:49825876-49825898 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1109176698 13:59166569-59166591 TTCCCCCACCCCCCAGTCTGTGG + Intergenic
1110453861 13:75668174-75668196 TCACTCTATCACCCAGGCTGGGG - Intronic
1110513708 13:76383785-76383807 TCTCCAAGCCACCCAGCCTGAGG + Intergenic
1111179678 13:84647165-84647187 TATGCTAACCACCCAGGCTGTGG + Intergenic
1113032879 13:106014090-106014112 TCTCCCCAACTTCTAGGCTGTGG + Intergenic
1113648706 13:112017238-112017260 TCTCTCTGCCACCCAGGCTGGGG - Intergenic
1113749175 13:112766653-112766675 TCTGCCCACCCCCCAGGATGGGG + Intronic
1114069679 14:19097382-19097404 TCTCAGCACCACGCAGGCCGCGG - Intergenic
1114092581 14:19302621-19302643 TCTCAGCACCACGCAGGCCGCGG + Intergenic
1115263719 14:31478727-31478749 TCTCACTGTCACCCAGGCTGAGG - Intergenic
1115302436 14:31899593-31899615 TCGCTCCACCTCCCAGGCTGGGG - Intergenic
1115431621 14:33325606-33325628 TCACCCTGTCACCCAGGCTGAGG - Intronic
1115483188 14:33882959-33882981 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1115556532 14:34548775-34548797 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1116363396 14:44029571-44029593 TCTCCCCTCCACAAAGGTTGGGG + Intergenic
1117088837 14:52228973-52228995 GGTCCCCAACACCCAGGCTGTGG - Intergenic
1117207589 14:53460086-53460108 TCTCCCCACCACCCAGATGATGG - Intergenic
1117394268 14:55293208-55293230 TCACTCTGCCACCCAGGCTGTGG + Intronic
1118198521 14:63650507-63650529 TCTCACCACCACCCACCCTCTGG - Intergenic
1118709258 14:68506363-68506385 CCTCCCCAACACTCAGGCTCGGG + Intronic
1118719494 14:68584067-68584089 CCCCCCCACCCCCCATGCTGGGG + Intronic
1119069751 14:71570816-71570838 TCGCTCTATCACCCAGGCTGGGG + Intronic
1119346806 14:73932091-73932113 TCTCCCCTTGGCCCAGGCTGAGG + Exonic
1119368988 14:74121753-74121775 TCACTCCGTCACCCAGGCTGGGG + Intronic
1119385085 14:74253015-74253037 TCACTCTGCCACCCAGGCTGGGG - Intronic
1119399570 14:74353255-74353277 TCACTCTATCACCCAGGCTGGGG - Intronic
1119478004 14:74942256-74942278 CCTTCCCACCAGCCAGGCCGTGG + Exonic
1119701375 14:76757701-76757723 TCACCCTATCACCTAGGCTGTGG + Intergenic
1119703968 14:76772794-76772816 TCTCTCCAGCCACCAGGCTGGGG - Intronic
1119881262 14:78101651-78101673 GCTCCACACCAGCCAGGCTTTGG - Intergenic
1120257118 14:82134926-82134948 TCTCCCTCTCACCCAGGCTGGGG + Intergenic
1120808914 14:88782615-88782637 TGTCCCCACCACTCCAGCTGTGG + Intronic
1120934639 14:89882698-89882720 TCTACCCACCTCTCAGTCTGTGG + Intronic
1120988591 14:90355248-90355270 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
1121468074 14:94128664-94128686 TCTCCCCACAGCCCTGGCAGTGG - Exonic
1121507101 14:94485828-94485850 TATACCCACCCCTCAGGCTGGGG + Intergenic
1121734078 14:96205853-96205875 GTTCACCTCCACCCAGGCTGCGG - Intronic
1122080086 14:99261070-99261092 TCTCCCCACCACCCAGGCTGTGG + Intronic
1122650554 14:103224040-103224062 TGCCCCCACCCTCCAGGCTGCGG + Intergenic
1122660011 14:103288879-103288901 TGTTCCCAACACCCAGGCTGTGG + Intergenic
1122873164 14:104650699-104650721 TCTCCCCATCTCCCAGCCTCGGG + Intergenic
1122985176 14:105208583-105208605 GCACCCCAGCACCCAGGCCGAGG + Intergenic
1124370036 15:29099267-29099289 CCTCCAAACCACCCAGCCTGTGG - Intronic
1124533927 15:30528001-30528023 TCTCACTGTCACCCAGGCTGGGG + Intergenic
1124577238 15:30920814-30920836 TCACTCCATCACCTAGGCTGGGG + Intronic
1124764720 15:32479608-32479630 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1124933804 15:34150560-34150582 TCGCTCTATCACCCAGGCTGGGG - Intronic
1125509483 15:40285104-40285126 TCTCTCCAGCTCCCAGGCTCCGG + Intronic
1125534885 15:40437132-40437154 CCTCCCCACCCCCAAGGCCGGGG + Intergenic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1125767774 15:42146640-42146662 GCTCCCCACCACCCCGTGTGTGG - Intronic
1125812133 15:42550567-42550589 TCTCCCCATCACCCAGACAATGG - Intronic
1125958596 15:43809460-43809482 TCTCGCTGTCACCCAGGCTGGGG - Intronic
1126639972 15:50814576-50814598 TCTCCCTACCCCCCAGCCTCTGG + Intergenic
1126828112 15:52571336-52571358 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1127438885 15:58986544-58986566 TCTCCCTGTCACCCGGGCTGGGG + Intronic
1127781741 15:62322650-62322672 TCTCCCTGTCACCCTGGCTGGGG + Intergenic
1127869226 15:63056633-63056655 TCGCTCTATCACCCAGGCTGGGG - Intronic
1128121717 15:65153372-65153394 AATCTCCACCTCCCAGGCTGAGG - Intronic
1128260272 15:66228315-66228337 TGTCCCCACCACCAAGACTACGG + Intronic
1128745783 15:70113391-70113413 TCTCCCCACCAACCCTCCTGAGG + Intergenic
1129686975 15:77691904-77691926 TGTCACCCCCACCCACGCTGCGG + Intronic
1129708226 15:77806737-77806759 TCTCCCCACAGCACAGGCAGAGG + Intronic
1129742400 15:77995789-77995811 TCACCCCAACACCCAGCCCGTGG - Exonic
1129806817 15:78468272-78468294 TCTCTCTGTCACCCAGGCTGAGG + Intronic
1129843083 15:78755688-78755710 TCACCCCAACACCCAGCCCGTGG + Intergenic
1129962616 15:79701294-79701316 TCTCCCCAACTGCCAGCCTGTGG - Intergenic
1130033911 15:80341018-80341040 CCTCCTCCCCATCCAGGCTGGGG + Intergenic
1130315844 15:82795798-82795820 TCGCTCCATCACCCAGGCTGAGG - Intronic
1130426919 15:83810768-83810790 TCACTCTATCACCCAGGCTGGGG + Intronic
1131259862 15:90882646-90882668 CCTCCCCACCACCCACCCAGGGG - Exonic
1131464468 15:92644508-92644530 CCTCCCCAACACAGAGGCTGGGG + Intronic
1132516578 16:368773-368795 TGATCCCACCCCCCAGGCTGGGG - Intronic
1132614928 16:835699-835721 TCTCCCCACACCTCAGCCTGAGG + Intergenic
1132814971 16:1821365-1821387 TCACCCCAACACAGAGGCTGGGG + Intronic
1132858320 16:2057496-2057518 TCACCCCCACAGCCAGGCTGTGG + Intronic
1132939168 16:2498551-2498573 TCCCCACACCACCCAGACTTTGG + Intronic
1132957168 16:2600477-2600499 ACTGCCCACCGCCCTGGCTGGGG - Exonic
1132969511 16:2678889-2678911 ACTGCCCACCGCCCTGGCTGGGG - Intergenic
1133151015 16:3830314-3830336 TCTGCCCCCCACCCCGGGTGAGG - Intronic
1133206970 16:4239782-4239804 TCTCCCCACCATCCAGGGAAGGG - Intronic
1133241272 16:4416028-4416050 TCTCCCCACAGCCCAGCCAGGGG + Intronic
1133734928 16:8607683-8607705 TCTCTCCAGCCCCCAGGCAGCGG - Intergenic
1133838199 16:9385214-9385236 TCTCACTCTCACCCAGGCTGGGG + Intergenic
1133971487 16:10571373-10571395 TCTCACCACCAACCACACTGGGG + Intronic
1134093428 16:11403646-11403668 TCTCCACACCTGGCAGGCTGTGG + Intronic
1134625944 16:15722770-15722792 TCACTCCATCACTCAGGCTGGGG + Intronic
1135302603 16:21343934-21343956 TCCAACCACCACCCAGCCTGGGG - Intergenic
1135349645 16:21717986-21718008 TCTCTCGGTCACCCAGGCTGGGG + Intronic
1135466774 16:22693436-22693458 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1135533087 16:23271460-23271482 TCACTCTATCACCCAGGCTGGGG + Intergenic
1135730075 16:24886934-24886956 TCACCCTGTCACCCAGGCTGGGG - Intronic
1135776981 16:25265421-25265443 TCCCTCCATCACCCAAGCTGGGG + Intergenic
1135868053 16:26123020-26123042 TCACTCTATCACCCAGGCTGGGG - Intronic
1135907446 16:26525758-26525780 TCACCCTGTCACCCAGGCTGGGG - Intergenic
1136054744 16:27680121-27680143 CCTCCCCACCCACCAGCCTGTGG + Intronic
1136241959 16:28950333-28950355 TCGCCCTGTCACCCAGGCTGGGG + Intergenic
1136299364 16:29323150-29323172 TCCAACCACCACCCAGCCTGGGG - Intergenic
1136624143 16:31451420-31451442 TCTCTCCCTCACCCAGGCTGGGG - Intergenic
1137040512 16:35607974-35607996 TCACTCTATCACCCAGGCTGGGG + Intergenic
1137709165 16:50554664-50554686 TCACTCTGCCACCCAGGCTGGGG + Intronic
1137971152 16:52986373-52986395 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1138246210 16:55468887-55468909 TCTCTCCACCACCCAACGTGGGG - Intronic
1138522741 16:57580447-57580469 TGGCCCTATCACCCAGGCTGGGG - Intronic
1138636307 16:58341317-58341339 TCACCCTGTCACCCAGGCTGGGG + Intronic
1138753689 16:59456146-59456168 TGTCCCCCTCACCCAGACTGGGG - Intergenic
1138774256 16:59702532-59702554 TTTCCCCTCCACACATGCTGAGG + Intergenic
1139851294 16:69952663-69952685 ATTCCCCACCAGCCCGGCTGGGG + Intronic
1139880274 16:70175575-70175597 GTTCCCCACCAGCCCGGCTGGGG + Intronic
1140372236 16:74419942-74419964 GTTCCCCACCAGCCCGGCTGGGG - Intronic
1140442110 16:74995972-74995994 TCTCCCCTCCCCCCAGGCCATGG + Intronic
1141174257 16:81708813-81708835 GCTCCCCACTGCCCAGGCAGAGG - Intronic
1141203360 16:81914068-81914090 CCTCCTCCCCATCCAGGCTGAGG - Intronic
1141447361 16:84069814-84069836 TCCTCCCACCACGGAGGCTGGGG + Intronic
1141501478 16:84447428-84447450 CCTCCCCACCACCCACCCAGAGG + Intronic
1141646981 16:85372824-85372846 CCTGCCCACCTCCCAGGGTGTGG - Intergenic
1141665156 16:85462137-85462159 TGTCCCCAGCACCCAGTCTCGGG + Intergenic
1141787744 16:86213095-86213117 TCTCCACACCACACAGACCGTGG + Intergenic
1141908772 16:87044525-87044547 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1142061107 16:88029977-88029999 TCCAACCACCACCCAGCCTGGGG - Intronic
1142402416 16:89867174-89867196 TCTCTCTGTCACCCAGGCTGCGG + Intronic
1203143577 16_KI270728v1_random:1784659-1784681 GCTCCCCATCACTCTGGCTGAGG + Intergenic
1142599162 17:1044733-1044755 GCTCCCCGCCACCCCTGCTGAGG + Intronic
1142601726 17:1056311-1056333 TCTCTCCTCCACTCAGCCTGGGG + Intronic
1142661718 17:1434749-1434771 TCACTCCATCGCCCAGGCTGGGG - Intronic
1142981154 17:3672487-3672509 TCTCCTCTCCCACCAGGCTGAGG - Exonic
1142985205 17:3691115-3691137 TATCCCCAAAACCCAGGCAGAGG - Intronic
1143199698 17:5103927-5103949 TCACTCCATCACCCAGACTGGGG + Intergenic
1143813637 17:9493231-9493253 TCTCTCTATCACCCAGGCTGGGG - Intronic
1144570997 17:16398928-16398950 TCTTCCAAACACCCAGGCTGGGG + Intergenic
1144579564 17:16450746-16450768 TCTCTCCATCTCCCAGTCTGAGG - Intronic
1144598954 17:16596496-16596518 TCCCCCCTCCTCCCAGGCTCTGG - Intergenic
1144835843 17:18156356-18156378 TCTTCCCTCCACCCAGGCTGAGG + Intronic
1144947435 17:18977099-18977121 TCTCCCCACTCCCCAGGTTGGGG - Intronic
1145016172 17:19399860-19399882 TCTGGGCAGCACCCAGGCTGTGG - Intergenic
1145032656 17:19516713-19516735 TCACTCTATCACCCAGGCTGGGG - Intronic
1145280300 17:21463124-21463146 TCTCCCTCCCACTCAGCCTGAGG + Intergenic
1145363116 17:22228534-22228556 TCTTCCAAACACCCAGGCTGGGG + Intergenic
1145397588 17:22507355-22507377 TCTCCCTCCCACTCAGCCTGAGG - Intergenic
1145847073 17:28049629-28049651 TCACCTCTCCACCAAGGCTGAGG - Intronic
1145973757 17:28972411-28972433 TCTTCTCAGCACCCAGTCTGAGG - Intronic
1145986525 17:29050791-29050813 TCACTCTATCACCCAGGCTGGGG - Intronic
1145987599 17:29057636-29057658 TCACCCCTCCACCCACCCTGGGG - Intergenic
1146045275 17:29500281-29500303 TCACTCTATCACCCAGGCTGAGG - Intronic
1146103250 17:30006679-30006701 TCACTCTATCACCCAGGCTGGGG + Intronic
1146277568 17:31525026-31525048 TTTCACCCCAACCCAGGCTGTGG - Intronic
1146299082 17:31674155-31674177 TCACCCTGCCACCCAGGCTGAGG - Intergenic
1146461664 17:33050773-33050795 TCTCCCCACCACCAAGCAGGAGG - Intronic
1146470497 17:33120662-33120684 TCCCCCAACCAGCCAAGCTGTGG - Intronic
1146588909 17:34110682-34110704 TCTACCAAGCACCCATGCTGAGG + Intronic
1147241742 17:39095103-39095125 TTTCCCCACCATCCGGGCTGGGG + Intronic
1147295806 17:39481355-39481377 TCTCACTGTCACCCAGGCTGGGG + Intronic
1147394020 17:40127510-40127532 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1147655565 17:42088681-42088703 TCCCCCCAACACCCAGGCTCTGG - Intergenic
1147962639 17:44177358-44177380 TCTCTCCCCCTCCCAAGCTGGGG - Intronic
1148009791 17:44468417-44468439 TCGCTCTGCCACCCAGGCTGGGG + Intronic
1148082681 17:44976306-44976328 TCTCCCCTCAGCCCAGCCTGCGG + Intergenic
1148125778 17:45236060-45236082 TTTCCCCACCACTCAGCCTCTGG - Intronic
1148579394 17:48733280-48733302 TCCCGCCCCCACCCAGGCTAGGG + Intergenic
1148588006 17:48794581-48794603 TCTCCTCCCCACCTGGGCTGTGG - Intronic
1148737210 17:49871538-49871560 GCTCCCTCCCACCCAGGCAGTGG - Intergenic
1148794309 17:50189807-50189829 TCTCCCCTCTCCCCAGGCAGCGG - Intronic
1148904363 17:50902531-50902553 TCACTCTATCACCCAGGCTGGGG - Intergenic
1149208271 17:54274454-54274476 TCTCTCCATCACCCAGGCCCAGG + Intergenic
1149314669 17:55427862-55427884 GGTCCCCAACCCCCAGGCTGTGG + Intergenic
1149623288 17:58061956-58061978 TCTACCCACAGCACAGGCTGGGG - Intergenic
1149876796 17:60242440-60242462 TCTCACCGTCACCCAGGCTGGGG + Intronic
1150306500 17:64089688-64089710 ACTCCCCTCCACCCCGGCTCGGG - Intronic
1151353809 17:73546649-73546671 TCTCCCCACCACCATGCCAGGGG - Intronic
1151439974 17:74122132-74122154 TCACTCCATCACTCAGGCTGGGG - Intergenic
1151766834 17:76137255-76137277 ACACCCCACCACCTAGGCAGGGG - Exonic
1152110909 17:78357410-78357432 CCTCCCCACTTCCCTGGCTGTGG + Exonic
1152316843 17:79585968-79585990 CCTTCCCATCTCCCAGGCTGGGG + Intergenic
1152500927 17:80708588-80708610 TGTCCCCACCCTCCAGGGTGTGG + Intronic
1152500946 17:80708661-80708683 TGTCCCCACCCTCCAGGGTGTGG + Intronic
1152577017 17:81146327-81146349 TCTCTCTGTCACCCAGGCTGCGG - Intronic
1152623665 17:81378866-81378888 TCTCCCCCTCACCCAGGATGGGG + Intergenic
1152758280 17:82096212-82096234 TGTCCTCACCACCCAGGCACTGG - Intronic
1153198059 18:2622819-2622841 TCTCACTCTCACCCAGGCTGGGG + Intergenic
1154152123 18:11914677-11914699 TCCCTCCGTCACCCAGGCTGGGG + Intergenic
1154422494 18:14246226-14246248 AGTCTCCATCACCCAGGCTGTGG - Intergenic
1155510669 18:26573243-26573265 TCTCCCCTCCCCCCAGCCTCTGG - Intronic
1155923979 18:31634092-31634114 TCTCCCCACCCCTCCAGCTGTGG - Intronic
1156552116 18:38028729-38028751 CCTCCCCACCAGGCAGGGTGTGG + Intergenic
1157826193 18:50814499-50814521 TCTCCTTACCACACAGTCTGTGG - Intronic
1157888281 18:51389728-51389750 CTTCTCCACCATCCAGGCTGGGG + Intergenic
1158437625 18:57444550-57444572 AGTCCCCACCCCCCAGGGTGAGG + Intronic
1158439330 18:57460175-57460197 TAACCCCAGCACACAGGCTGAGG - Intronic
1159060731 18:63511372-63511394 TCTCTCCAGTACCCAGGCTTTGG - Intergenic
1159413760 18:68116987-68117009 TCTCCCCACCACCCAGCCCCTGG - Intergenic
1159851991 18:73535378-73535400 AGTCACCACCACCTAGGCTGGGG - Intergenic
1160143682 18:76347661-76347683 TCTCCACACCAATCAGGTTGGGG - Intergenic
1160772617 19:839828-839850 TCTCCCTCCCACTCAGGGTGTGG - Intergenic
1160951931 19:1671973-1671995 TTTCCCCACCTCCCAGGGAGAGG - Intergenic
1161172718 19:2820980-2821002 TATACCCACCACCCATGTTGAGG + Intronic
1161193446 19:2972582-2972604 TCGCTCTATCACCCAGGCTGGGG - Intergenic
1161325796 19:3663382-3663404 ACCCCCCACCACCCAGAGTGTGG - Intronic
1161355829 19:3819224-3819246 TCTCCCCACAGCCCGGGCGGCGG - Exonic
1161432642 19:4242475-4242497 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1161464131 19:4418445-4418467 TCGCTCTGCCACCCAGGCTGGGG + Intronic
1161710679 19:5846018-5846040 TTGCTCCATCACCCAGGCTGGGG - Intronic
1161828554 19:6586211-6586233 CCACCCCACCACCCTGGCCGTGG - Exonic
1162028356 19:7906555-7906577 TCTCGCTGTCACCCAGGCTGGGG - Intronic
1162054017 19:8052257-8052279 TCTCCCCTCCCCCCATCCTGTGG + Intronic
1162164152 19:8740847-8740869 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162165223 19:8748316-8748338 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162166288 19:8755770-8755792 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162167354 19:8763226-8763248 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162168295 19:8769526-8769548 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162169362 19:8776979-8777001 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162170042 19:8782291-8782313 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162171127 19:8789944-8789966 TCTCCCCACTCCAGAGGCTGAGG - Intergenic
1162378383 19:10317989-10318011 TCTCTCTACAGCCCAGGCTGTGG - Intronic
1162901618 19:13798490-13798512 TCTTCCCACCCACCAGGCTTTGG - Intronic
1162983089 19:14251416-14251438 TCACTCTATCACCCAGGCTGGGG + Intergenic
1163307757 19:16492403-16492425 TCGCCCTGCCACCCAGGCTGGGG - Intronic
1163410398 19:17150374-17150396 TCACTCTGCCACCCAGGCTGGGG - Intronic
1163699837 19:18781593-18781615 ACTCCCCAGCACCCAGGCCTGGG - Exonic
1163724104 19:18912890-18912912 TGTCCCCGCCACCCACTCTGTGG + Intronic
1163793748 19:19323536-19323558 TCGCTCCATCACCCCGGCTGGGG + Intronic
1163822393 19:19503320-19503342 TCCCCCCACCACTCTGCCTGGGG - Intronic
1164017367 19:21264843-21264865 GCTCCTCACTTCCCAGGCTGTGG - Intronic
1165308559 19:35017141-35017163 TCTCTCTGTCACCCAGGCTGAGG - Intronic
1165359392 19:35326636-35326658 TCTCCCAACCCCCCAGGTTCAGG - Intronic
1165386510 19:35513415-35513437 CCTCCCCACTGCCCAGGCAGAGG + Exonic
1165424488 19:35738443-35738465 GCTCCTCACCACGCAGGATGCGG - Exonic
1165467299 19:35982597-35982619 GCTCCCCACTCCCCATGCTGAGG + Intergenic
1165706508 19:37980005-37980027 TCTCCCCACCCACCGGCCTGTGG - Intronic
1166060999 19:40325594-40325616 TCACTTCATCACCCAGGCTGGGG - Intronic
1166067703 19:40369892-40369914 TCTCCCCTCCCCGCAGGGTGAGG + Exonic
1166213863 19:41323541-41323563 TCTCCCCAGGACCCAGGCTGTGG + Exonic
1166680431 19:44762851-44762873 TCACTCTATCACCCAGGCTGGGG + Intergenic
1166788565 19:45384107-45384129 TCACTCTGCCACCCAGGCTGCGG + Intronic
1166910851 19:46155298-46155320 TCTCCCCAGCTCCCAGCCTAGGG - Intronic
1166923120 19:46245474-46245496 TCTCCCCAGCTCCCAGCCTAGGG + Intergenic
1166941552 19:46369598-46369620 TCGCCCTGTCACCCAGGCTGGGG - Intronic
1167986760 19:53324997-53325019 GGTCCCCAGCCCCCAGGCTGTGG + Intergenic
1168104159 19:54156479-54156501 TCTCCCCATCACACAGCCTCTGG + Intronic
1168356573 19:55703920-55703942 TCTTCCCACAACCCCGCCTGCGG - Intronic
1168517982 19:57024451-57024473 TCACTCCATCACTCAGGCTGGGG + Intergenic
1168540211 19:57203788-57203810 ACTACCCACCACCCACTCTGTGG + Intronic
1168720035 19:58549797-58549819 TGTCTGCACCATCCAGGCTGAGG - Exonic
925038226 2:708710-708732 TCTCCCCATCACCCTGGAGGAGG - Intergenic
925083051 2:1084732-1084754 TCACCAGACCACCCAGCCTGCGG - Intronic
925402762 2:3587321-3587343 TCTCCCCACCCCTCGGGCTCAGG - Intergenic
925771398 2:7285916-7285938 TCACCCTGTCACCCAGGCTGGGG - Intergenic
925804709 2:7636856-7636878 TCACTCTGCCACCCAGGCTGGGG + Intergenic
926227015 2:10973921-10973943 TCTCCCACGCCCCCAGGCTGGGG + Intergenic
926532091 2:14060846-14060868 CCTCCCTACCACCCAAGCTGTGG - Intergenic
926750716 2:16196701-16196723 TCTCCCCAGCACGCAGGTGGTGG - Intergenic
927321824 2:21756197-21756219 TGTTCCCAACTCCCAGGCTGTGG + Intergenic
927751343 2:25673349-25673371 TCTCCCCACAGCCCCGGCGGCGG + Intronic
928154762 2:28866643-28866665 GCTCCCCTACCCCCAGGCTGAGG - Intronic
928242063 2:29595350-29595372 TCTCGCTGTCACCCAGGCTGGGG + Intronic
929782597 2:44966681-44966703 GCTCCCCACCACCCTCACTGAGG - Intergenic
930683013 2:54277644-54277666 TCTCTCTATCGCCCAGGCTGGGG - Intronic
930706648 2:54511019-54511041 TCAGCCCAACACCCAGGCTGGGG - Intronic
932036783 2:68253202-68253224 TCTCCCCACGCCTCGGGCTGCGG - Intronic
932054333 2:68429577-68429599 GTTCCCCAACCCCCAGGCTGTGG + Intergenic
932313557 2:70764474-70764496 CCTTCCCTTCACCCAGGCTGTGG + Intronic
932347303 2:71004108-71004130 TCTCCACTCCACCCAGACAGAGG + Intergenic
933650074 2:84843410-84843432 TCTCCTCACCACTCAGAATGAGG - Intronic
933968587 2:87451498-87451520 TCTCTTCATCACCCAGCCTGTGG + Intergenic
934479146 2:94618886-94618908 TCTCATCACCGCTCAGGCTGTGG - Intergenic
934657086 2:96122054-96122076 CCCTCCCACCACCCAGGCTGGGG + Intergenic
934968788 2:98746227-98746249 TTTCTCCATCACCCAAGCTGGGG + Intergenic
935030580 2:99317920-99317942 TCACTCCGTCACCCAGGCTGGGG + Intronic
935778692 2:106493416-106493438 TCTCCCCTAGACCCAGGCGGCGG + Intergenic
936087497 2:109479249-109479271 TCTGCCCAGCACACAGGGTGGGG + Intronic
936267812 2:111023678-111023700 TCTGCCCTCCAGCCACGCTGAGG - Intronic
936325207 2:111499007-111499029 TCTCTTCATCACCCAGCCTGTGG - Intergenic
936575797 2:113654064-113654086 TCTTCCCACCCCCCAGCCTCTGG + Intergenic
937264788 2:120608682-120608704 TCTCCCCACCATTCAGCCAGAGG - Intergenic
938034201 2:128022859-128022881 TCACTCCGTCACCCAGGCTGGGG + Intronic
938048597 2:128146277-128146299 TCACTCCATCACCCAGGCTGGGG - Intronic
938630444 2:133160932-133160954 TGTCCCCAGCCCCCAAGCTGTGG + Intronic
938799259 2:134745771-134745793 TCTGCCCAGCACCCAGCATGAGG + Intergenic
939031445 2:137080230-137080252 TCACTTCATCACCCAGGCTGGGG + Intronic
939936365 2:148298308-148298330 TCTCCCCACCTCCCAGCCAAGGG - Intronic
940518568 2:154713472-154713494 TCCCCCCACCACTCCTGCTGAGG - Intronic
940769517 2:157825410-157825432 GGTCCCCAACCCCCAGGCTGTGG + Intronic
940886093 2:158990507-158990529 TCTCCCAACCCTCCAGGCAGAGG - Intronic
940932503 2:159450343-159450365 TCACTCCGTCACCCAGGCTGTGG - Intronic
940961275 2:159789047-159789069 TCTCTCTGTCACCCAGGCTGGGG + Intronic
941634373 2:167919565-167919587 TCTCACTGTCACCCAGGCTGGGG - Intergenic
941818538 2:169823015-169823037 TATCTCTATCACCCAGGCTGGGG + Intronic
941955982 2:171204919-171204941 TCACTCTATCACCCAGGCTGGGG - Intronic
942864053 2:180650821-180650843 TCTCCCCACCACCCAAGGAAAGG - Intergenic
943573575 2:189603353-189603375 TCACTCCATCACCCAGGCTGGGG - Intergenic
945978829 2:216292213-216292235 TCTCCCCCTCACCAAGGGTGGGG - Intronic
946026186 2:216673252-216673274 TCTCCCCACCACCACCTCTGTGG - Exonic
946235963 2:218324320-218324342 TCTCCCCACAACCTGGCCTGTGG - Intronic
946637022 2:221740541-221740563 TCTCCCCACCACTCAGCCCTTGG - Intergenic
946774184 2:223120236-223120258 TCTCCCCACCCCTCAGCCTCTGG + Intronic
946990843 2:225327972-225327994 GTTGGCCACCACCCAGGCTGGGG + Intergenic
947342226 2:229152100-229152122 ACTCCCCACCTCCCAGGGTACGG + Intronic
947446662 2:230169338-230169360 TTTCCCCGTCACCCAGGCTGTGG + Intronic
948017736 2:234703489-234703511 CCCTCCCACCACCCAAGCTGAGG - Intergenic
948305797 2:236945853-236945875 TCTCTCCTCCTCCCAGGATGAGG - Intergenic
948306854 2:236954765-236954787 GTCCCCCACCACCCAAGCTGGGG - Intergenic
948693690 2:239722216-239722238 TTTCCGCACCTCTCAGGCTGTGG - Intergenic
948732471 2:239975767-239975789 TCTCCCCACCTCGCAGGCCATGG + Intronic
948797513 2:240412452-240412474 CCGCCCCACCCCCCAGGCTTTGG + Intergenic
1168756089 20:318917-318939 TCTCCCTGTCACCCAGGATGGGG - Intergenic
1168756499 20:322053-322075 TCTTTCCATCACCCAGTCTGGGG + Intergenic
1168946627 20:1765265-1765287 TCACTCCATCGCCCAGGCTGGGG - Intergenic
1169197906 20:3693238-3693260 GCTCCCAACCACCCAGTCTGAGG + Intronic
1169491843 20:6077710-6077732 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1170171552 20:13419005-13419027 TCTCCCCACCACCAAGTCCAGGG - Intronic
1170560841 20:17557095-17557117 TCTCCCCACCAGTGAGGCAGTGG - Intronic
1171538682 20:25924762-25924784 TCTACCCACTACCCAAGCTCTGG + Intergenic
1172371286 20:34394178-34394200 TCACCCTATCACCCAGGCTGGGG - Intronic
1172755070 20:37277996-37278018 TCACTCCGACACCCAGGCTGGGG + Intergenic
1172966020 20:38835894-38835916 CCTCCCCAACGCCCTGGCTGGGG - Exonic
1173095625 20:40025321-40025343 AGTCCCCATCCCCCAGGCTGTGG - Intergenic
1173650808 20:44662986-44663008 TGTCCCCAGCACCTAGCCTGGGG - Intergenic
1173833499 20:46109131-46109153 GATCCCCAACACCCCGGCTGTGG + Intergenic
1173855156 20:46245613-46245635 TCTCCCCAGCACCCAGCACGGGG + Intronic
1173981075 20:47224594-47224616 TAACCCCACACCCCAGGCTGGGG - Intronic
1174131934 20:48351140-48351162 TCTTCCCACCAGCTTGGCTGAGG + Intergenic
1174248051 20:49196738-49196760 TCTCGCTGTCACCCAGGCTGGGG - Intergenic
1175211678 20:57361841-57361863 GGTCCCCAACCCCCAGGCTGTGG + Intronic
1175914023 20:62417374-62417396 TGTCCCCACCATCCAGCCTGGGG + Intronic
1176309759 21:5143193-5143215 CATCTCTACCACCCAGGCTGGGG + Intronic
1177463986 21:21450373-21450395 TCGCTCTATCACCCAGGCTGGGG + Intronic
1177915556 21:27084566-27084588 TCACCCCACCTCCCTGCCTGTGG + Intergenic
1179170456 21:38969025-38969047 CCTCCTCTCCACCCAGCCTGAGG - Intergenic
1179375003 21:40842180-40842202 CCTCCCTATCTCCCAGGCTGAGG + Intronic
1179510775 21:41871795-41871817 CCTCTCCAGCACCCAGGCTCAGG + Intronic
1180109179 21:45640040-45640062 TGTCACCATCACCCAAGCTGGGG + Intergenic
1180488148 22:15819945-15819967 TCTCAGCACCACGCAGGCCGCGG - Intergenic
1180895602 22:19329767-19329789 TGTCACCACCACCCAGTGTGTGG - Intergenic
1180970035 22:19810478-19810500 ACTCCCCTGCACCCAGGATGTGG - Intronic
1181000149 22:19984295-19984317 TATCCCTCCCACCAAGGCTGTGG + Intronic
1181108796 22:20589723-20589745 TCTAGTGACCACCCAGGCTGGGG + Intergenic
1181167528 22:20991663-20991685 GCTCCCCACCACCCCCGCAGCGG + Exonic
1181455689 22:23059034-23059056 CCTTCCCATCACCCAGGGTGGGG + Intergenic
1181543557 22:23587604-23587626 CCTCCCCACCATCCAGGCCAGGG + Intergenic
1181673012 22:24434592-24434614 GCCCACAACCACCCAGGCTGTGG - Intronic
1181863711 22:25839412-25839434 AATCCCCTCCACACAGGCTGGGG + Intronic
1182389319 22:29978133-29978155 TCTCACTATCACCCAGGCAGTGG - Intronic
1182648749 22:31833092-31833114 TCACTCTATCACCCAGGCTGGGG + Intronic
1182665804 22:31958986-31959008 TCTTCCTATCTCCCAGGCTGGGG - Intergenic
1182786025 22:32908420-32908442 TCTCTGTATCACCCAGGCTGGGG + Intronic
1182788133 22:32925058-32925080 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1182917042 22:34043628-34043650 CCTCCCCATCTCCCAGGCAGGGG - Intergenic
1183184613 22:36284950-36284972 TCCCCCAACCACCCAACCTGTGG + Intronic
1183280391 22:36929090-36929112 GCTCCCCACTGCCCACGCTGCGG - Intronic
1183301661 22:37061825-37061847 CCTCCCCACCAGCCTGGCTCTGG - Intronic
1183515982 22:38266356-38266378 TCTGCCCACCTCACAGGCTCTGG - Intronic
1183805547 22:40207373-40207395 TCACTCCATCGCCCAGGCTGGGG - Intronic
1184142691 22:42587476-42587498 TCTCCCCAGCACCCCGCCTTTGG + Intronic
1184558788 22:45248985-45249007 TCTCCCCACCCCCAAAGCTTTGG + Intergenic
1184816447 22:46875481-46875503 TCTCACTCCCACCCAGACTGCGG + Intronic
1184864409 22:47194263-47194285 TCTTTCCACCCCCCAGACTGGGG + Intergenic
1184897790 22:47422057-47422079 TCTCTCTCCCACCCAGGCTAAGG + Intergenic
1185085936 22:48741091-48741113 TGTTCCCACCACCCTGGCTGTGG + Intronic
1185300333 22:50076521-50076543 TCACTCCATCAGCCAGGCTGGGG - Intronic
1185359257 22:50395590-50395612 TCACTCCATCGCCCAGGCTGGGG + Intronic
1185366387 22:50438817-50438839 CCTCCACAACACCCAGGCCGGGG - Intronic
1185424612 22:50759394-50759416 TCTTCCCACCCCCCAGCCTCTGG - Intergenic
949276917 3:2294597-2294619 TCTCACTGTCACCCAGGCTGTGG - Intronic
950004505 3:9682968-9682990 TCCCTCCACCACTCAGCCTGTGG - Intronic
951210143 3:19965789-19965811 TCTCACTGCCACCCAGGCTCAGG + Intronic
951909069 3:27730476-27730498 CCTCCCCACCTCCCAGCCTTTGG + Intergenic
952890401 3:38036566-38036588 TCACTCTATCACCCAGGCTGGGG - Intergenic
953533075 3:43755628-43755650 TCTGGCCTCCACCCAGGCTCAGG + Intergenic
953730012 3:45439251-45439273 TCACTCCATCGCCCAGGCTGGGG + Intronic
953914019 3:46906557-46906579 TCTGGCCACCTCCCAGGGTGAGG - Intergenic
954300031 3:49696070-49696092 TCTCGCCACCACCCAGCCAGGGG - Intronic
954751969 3:52818914-52818936 TCTCCCCACTACCCAGTGTATGG - Exonic
954832691 3:53436110-53436132 TCACCCTGTCACCCAGGCTGGGG + Intergenic
955045662 3:55357574-55357596 CCTCCACACCCCCCAGTCTGTGG + Intergenic
955064122 3:55520021-55520043 TCACTCTATCACCCAGGCTGGGG - Intronic
955156109 3:56418262-56418284 TCGCTCCATCACCCAGGCTGGGG - Intronic
956213842 3:66827951-66827973 TCTCCCCACACCCCTGGCTATGG - Intergenic
956280407 3:67550369-67550391 TCACTCTATCACCCAGGCTGGGG + Intronic
957113723 3:75997522-75997544 TCTCTCTGTCACCCAGGCTGGGG + Intronic
957362426 3:79176487-79176509 TCTCTCTGTCACCCAGGCTGGGG + Intronic
957377097 3:79372166-79372188 GGTCCCCAACACCCTGGCTGTGG - Intronic
957379399 3:79406397-79406419 TCTCTCTGCCACCCAGTCTGGGG - Intronic
959147902 3:102571711-102571733 TCACATCACCACCCATGCTGTGG - Intergenic
959262106 3:104095484-104095506 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
959592946 3:108099319-108099341 TCACTCCAGGACCCAGGCTGAGG - Intergenic
959620924 3:108397904-108397926 CCTCCCCAGCATCCTGGCTGTGG + Intronic
960819304 3:121710823-121710845 TCACTCCATCACCCAGGCTGGGG - Intronic
961380266 3:126492302-126492324 TCTCCCCACCCAGAAGGCTGTGG + Intronic
961414740 3:126749089-126749111 ACTCTCTACCACCCAGGCCGGGG - Intronic
961417014 3:126766679-126766701 TCTTCCCACAAGCCAGGCTCTGG + Intronic
961832382 3:129630338-129630360 TCTCACTGTCACCCAGGCTGGGG + Intergenic
961862307 3:129926709-129926731 TCGCCCTGTCACCCAGGCTGGGG - Intergenic
961971416 3:130972294-130972316 GCTCCCCAACTCCCAGGCAGTGG - Intronic
962010882 3:131389812-131389834 TCTCCCTGTCACCCAGGCTAGGG - Intergenic
962315039 3:134354044-134354066 TGTCCCCACCAACAGGGCTGGGG - Intergenic
962796126 3:138851038-138851060 TCGCTCCATCACCCAGGCTGGGG + Intergenic
962857623 3:139363227-139363249 TCTCCCAAACAACCAGTCTGTGG + Intronic
963129153 3:141841936-141841958 TCTCTCAGCCGCCCAGGCTGGGG - Intergenic
964088925 3:152850351-152850373 TCTCCCCATAGCCCAGGGTGTGG + Intergenic
964341179 3:155710017-155710039 TCACTCCGTCACCCAGGCTGGGG + Intronic
964482576 3:157157045-157157067 ACTCCACATCACCCAGGCTTTGG + Intronic
964571991 3:158117655-158117677 TCACCCTATCACCCAGGCTGGGG + Intronic
964876853 3:161377122-161377144 CCTCCCCACCTCCCTGTCTGTGG + Intergenic
965546097 3:169917967-169917989 TCTCTCTGTCACCCAGGCTGGGG + Intronic
966005646 3:175008347-175008369 TCACTCGGCCACCCAGGCTGAGG - Intronic
966196986 3:177323655-177323677 TCTCCCCAAACCCCAGTCTGAGG - Intergenic
967183932 3:186929919-186929941 TCCCTTCACCATCCAGGCTGAGG + Intergenic
967619741 3:191618418-191618440 TCTCACTGTCACCCAGGCTGGGG - Intergenic
967697735 3:192552857-192552879 TCACCCTGTCACCCAGGCTGGGG - Intronic
967818105 3:193815863-193815885 TCTCCCCACCTACCCAGCTGTGG - Intergenic
968658424 4:1788524-1788546 CCTCCCCCACTCCCAGGCTGGGG + Intergenic
968919635 4:3515795-3515817 GGTCCCCTCCCCCCAGGCTGTGG + Intronic
968964435 4:3762880-3762902 ACTCCCCTCCACCCGAGCTGAGG + Intergenic
968976928 4:3826986-3827008 TCCCGCCAACACCCAGGCTTTGG - Intergenic
969037681 4:4268355-4268377 TCTAGGCACCACCCTGGCTGAGG + Intronic
969153811 4:5192868-5192890 TCTCCCCTCCACCCAGCCCCTGG + Intronic
969487748 4:7481685-7481707 CCTCCCCACCACCGAGGCTCAGG - Intronic
969493608 4:7513523-7513545 GCTCCCCAGCACCCAGGCTGTGG - Intronic
969601517 4:8179295-8179317 CCTCCCCACCTGCCAGACTGTGG - Intergenic
969653140 4:8479425-8479447 CCTGCCCCACACCCAGGCTGTGG + Intronic
969697038 4:8740809-8740831 CCTCTCCCACACCCAGGCTGGGG + Intergenic
969711385 4:8846285-8846307 TCTCCACACTGCACAGGCTGAGG + Intronic
970008896 4:11436917-11436939 TGTCCCCAGCCCCCAGGTTGTGG - Intergenic
970236426 4:13963178-13963200 TCTCTCTGTCACCCAGGCTGTGG + Intergenic
970924454 4:21434745-21434767 CCTCCCCACAACCCTGTCTGTGG + Intronic
970951752 4:21764827-21764849 TCTCCCCTCCAGCTAGTCTGGGG - Intronic
971223681 4:24732384-24732406 TCTCCCCAGCATCCAGGATTGGG - Intergenic
971404682 4:26311505-26311527 TCTCTCTCTCACCCAGGCTGGGG - Intronic
972062559 4:34895315-34895337 TCACCCCGTCGCCCAGGCTGGGG - Intergenic
972445290 4:39137586-39137608 TCATTCCATCACCCAGGCTGGGG - Intergenic
974795108 4:66738653-66738675 TCCCTCTACCACCCAGGCTGGGG + Intergenic
975337063 4:73190335-73190357 TCATCCCATCACCCAGGCTGGGG - Intronic
975530433 4:75394555-75394577 CCTACCCACCACCCAATCTGAGG - Intergenic
975602289 4:76114041-76114063 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
977197120 4:94077046-94077068 TCTCACCAGCTCCCAGACTGTGG + Intergenic
980296739 4:130928905-130928927 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
980949384 4:139358222-139358244 TCACTGCATCACCCAGGCTGGGG + Intronic
981312893 4:143314096-143314118 TCTCTTCTCCACCCAGTCTGGGG - Intergenic
982205457 4:152994477-152994499 TCACTCTATCACCCAGGCTGGGG + Intergenic
983437413 4:167732707-167732729 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
984819278 4:183866060-183866082 TCTCCCCTTCACCTATGCTGTGG - Intronic
985588858 5:754673-754695 CCTTCTCTCCACCCAGGCTGAGG - Intronic
985603539 5:847189-847211 CCTTCTCTCCACCCAGGCTGAGG - Intronic
986479157 5:8167350-8167372 TCTCTCAGTCACCCAGGCTGGGG + Intergenic
988028593 5:25732499-25732521 TCTCTCTGCCACCCAGGCTGGGG + Intergenic
988419398 5:30987310-30987332 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
988624177 5:32853216-32853238 TCTCTCCATCACTAAGGCTGAGG - Intergenic
989686876 5:44099548-44099570 TCACTCTGCCACCCAGGCTGGGG - Intergenic
990601896 5:57367403-57367425 TGGAGCCACCACCCAGGCTGTGG + Intergenic
991723017 5:69511441-69511463 TCTCACTGTCACCCAGGCTGGGG + Intronic
991935217 5:71794070-71794092 GCTCCCCACCTCCCAGACAGGGG + Intergenic
992211410 5:74483559-74483581 GGTCCCCAACTCCCAGGCTGGGG + Intergenic
992794272 5:80241667-80241689 TCACCCTGTCACCCAGGCTGGGG - Intronic
993035542 5:82752521-82752543 TCTCCTCTCCACCCAGCCTGTGG + Intergenic
993065394 5:83091519-83091541 CCTCCCTACCACCCAGCCTCTGG + Intronic
993116113 5:83722084-83722106 TCTCGCCTCCACCCTGGCCGCGG - Intergenic
993369190 5:87071386-87071408 TCACTCCATCGCCCAGGCTGGGG + Intergenic
993770546 5:91919279-91919301 CCACCCCCCCACCCAGTCTGTGG - Intergenic
995002938 5:107157701-107157723 ACTCACCACCTCCCTGGCTGGGG - Intergenic
995014476 5:107294495-107294517 TCTCCCCACCCACCAGGCACTGG + Intergenic
995016011 5:107309707-107309729 TCTCACTGTCACCCAGGCTGGGG + Intergenic
995282295 5:110349896-110349918 TCTCTCTGTCACCCAGGCTGAGG - Intronic
995746360 5:115408234-115408256 AGTCCCCAACCCCCAGGCTGTGG + Intergenic
996378469 5:122840279-122840301 TCACTCTATCACCCAGGCTGGGG - Intergenic
997236056 5:132272472-132272494 TCTGCCTTCCACCCAGGCTGTGG - Exonic
997281067 5:132646048-132646070 TCTGCCACCCACCCAGGCTGGGG - Exonic
997290468 5:132729418-132729440 TCACCCTGTCACCCAGGCTGGGG - Intronic
997415133 5:133722307-133722329 TTCCCCCACCACCCAGTCTGTGG + Intergenic
997532865 5:134593018-134593040 TCACTCTGCCACCCAGGCTGGGG - Intergenic
997698992 5:135883209-135883231 TCTCATCCCCACCCCGGCTGGGG + Intronic
998387568 5:141766584-141766606 TTTCCCCAACAACCAGGCAGGGG + Intergenic
998447827 5:142211922-142211944 TCTTCCCGGCCCCCAGGCTGTGG - Intergenic
1000039712 5:157476250-157476272 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1000441653 5:161270886-161270908 TCCCCCCACCACCCATTCAGGGG - Intergenic
1001537551 5:172508753-172508775 TCTTCCCACCACCATGGCAGGGG - Intergenic
1001559384 5:172659344-172659366 TCTGGGCACCACCCAGGCTGGGG + Intronic
1002187412 5:177460809-177460831 TCGCCCTACCACCCAGGCTGGGG + Intronic
1002367245 5:178723203-178723225 TCTCCCCAGCACAGGGGCTGTGG + Intronic
1002819378 6:710846-710868 TCTACCCACGACCCGGCCTGGGG - Intergenic
1003058205 6:2841709-2841731 ACCCCCCACCCCCCAGGCTCAGG - Intronic
1003112271 6:3259969-3259991 TCTCACTGTCACCCAGGCTGGGG + Intronic
1003696690 6:8412933-8412955 GCTCCCAACCACCCAGGCCGTGG - Intergenic
1004170018 6:13288568-13288590 TCTCCCCACCACAAACCCTGTGG + Exonic
1004479651 6:16006424-16006446 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1005053459 6:21707503-21707525 TCACTCTATCACCCAGGCTGGGG - Intergenic
1005735317 6:28740302-28740324 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1006077810 6:31545575-31545597 TCTCCCTACCCCCCAGGCCATGG - Exonic
1006126092 6:31839265-31839287 TATCCCCATCACCCAGGTAGTGG + Intronic
1006454463 6:34123898-34123920 TCCCCCCAGCCCCCAGCCTGAGG - Intronic
1006474379 6:34245204-34245226 TGTCCCCACCACCAAGGGAGTGG - Exonic
1006510807 6:34520112-34520134 TCTCCCCACAACCCAGGCTAGGG - Intronic
1006721015 6:36151308-36151330 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1006761489 6:36466102-36466124 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1007092809 6:39194564-39194586 TCTGCCCAACACCCAGGGTAGGG + Intronic
1007231313 6:40349336-40349358 TCCCCCTCCCACCCCGGCTGTGG + Intergenic
1007519342 6:42439373-42439395 TGTCCCCAGCACCCATCCTGGGG - Intronic
1007587737 6:43002193-43002215 TCGCCCTATCACCCAGGCTGGGG + Intronic
1007766697 6:44164919-44164941 ACTCTCTGCCACCCAGGCTGGGG + Intronic
1008130224 6:47712909-47712931 GGTCCCCAACACCCAGGCAGTGG + Intronic
1008578676 6:52885707-52885729 TCGCCCTGTCACCCAGGCTGTGG + Intronic
1008841310 6:55908152-55908174 TCTCTCTGTCACCCAGGCTGGGG - Intergenic
1008886003 6:56432174-56432196 TCTTCCCACAAGCCAGGCTCTGG + Intergenic
1009434542 6:63602947-63602969 TCACTCTATCACCCAGGCTGGGG + Intergenic
1009517771 6:64641662-64641684 GGTCTCCAACACCCAGGCTGGGG + Intronic
1009937549 6:70251513-70251535 TCTCTCAATCACCCAGGTTGGGG - Intronic
1009958324 6:70484806-70484828 TAACCCCAACACCCAGACTGTGG - Intronic
1010413681 6:75589526-75589548 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1010776620 6:79894025-79894047 GGTCCCCAGCCCCCAGGCTGTGG + Intergenic
1010880567 6:81164187-81164209 TATCCCCACCACCGATTCTGAGG + Intergenic
1011141219 6:84159594-84159616 TTGCTCCATCACCCAGGCTGAGG + Intronic
1013063371 6:106659431-106659453 TCACTCCGTCACCCAGGCTGGGG - Intronic
1013538488 6:111085301-111085323 TCTCACTGTCACCCAGGCTGGGG + Intergenic
1015205355 6:130631939-130631961 TATCCCCACCCCCAAGCCTGCGG + Intergenic
1017319854 6:153077903-153077925 TCGCTCCATCACCCAAGCTGGGG + Intronic
1017928162 6:158928430-158928452 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1018903392 6:168062303-168062325 TATCCCCGGCACCCGGGCTGTGG + Intronic
1019188067 6:170232620-170232642 CATCCCCCCCACCCAGGGTGGGG - Intergenic
1019280445 7:197162-197184 ACTCCCCACCACCCAGAAAGGGG - Intronic
1019319164 7:407705-407727 GCTCCCCACACCCAAGGCTGTGG + Intergenic
1019533019 7:1513088-1513110 TCTGCCCCACACCCAGGATGGGG + Intergenic
1019552648 7:1610752-1610774 TGCCCCCACCCCCCAGGCTGCGG - Intergenic
1019653534 7:2173828-2173850 TCACTCTGCCACCCAGGCTGGGG + Intronic
1019696852 7:2450999-2451021 TCGCCCTGTCACCCAGGCTGAGG + Intergenic
1019767964 7:2865391-2865413 CCTCCCCACCTCCCCGGCTATGG + Intergenic
1020066946 7:5195452-5195474 TCACTCTGCCACCCAGGCTGGGG - Intronic
1020243986 7:6416629-6416651 TCTCCCCACCCCGGGGGCTGTGG - Exonic
1020262881 7:6540550-6540572 TCACTCTGCCACCCAGGCTGGGG + Intronic
1020274036 7:6614445-6614467 TCACTCTATCACCCAGGCTGGGG + Intergenic
1020435670 7:8159666-8159688 TCTCACTGTCACCCAGGCTGGGG - Intronic
1020992597 7:15219637-15219659 ACTCTTCAGCACCCAGGCTGTGG + Intronic
1021722947 7:23521470-23521492 TCTCCCTGGCACCCAGGCTGTGG + Intronic
1022636282 7:32139165-32139187 TTTCTCCATCACCCAGGCTGGGG + Intronic
1023664571 7:42509452-42509474 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1023982303 7:45077182-45077204 TCTCCCTCCTGCCCAGGCTGGGG + Intergenic
1024236344 7:47401917-47401939 CCTCCCCAACCCCGAGGCTGTGG + Intronic
1024260922 7:47573325-47573347 TCTCTCCACCTCCCACCCTGGGG + Intronic
1025225967 7:57163632-57163654 TCTTCCTGTCACCCAGGCTGTGG + Intergenic
1025650885 7:63468015-63468037 TCTCCCTGTCACCCATGCTGGGG + Intergenic
1026002676 7:66574073-66574095 TCACTCCATCACCCAGGCTGGGG + Intergenic
1026250815 7:68669024-68669046 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1026345753 7:69472861-69472883 TCACTTCATCACCCAGGCTGGGG + Intergenic
1026620439 7:71945450-71945472 GCTCCTCATCGCCCAGGCTGTGG + Intronic
1026776253 7:73232829-73232851 TTGCTCCATCACCCAGGCTGGGG - Intergenic
1026933274 7:74237143-74237165 TCTCACCATCACCCAGGCTGGGG + Intronic
1027017107 7:74786201-74786223 TTGCTCCATCACCCAGGCTGGGG - Intronic
1027491362 7:78831431-78831453 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1028274038 7:88829114-88829136 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1028301877 7:89210114-89210136 TCTCACTCTCACCCAGGCTGGGG - Intronic
1028469549 7:91190519-91190541 TCACTCTATCACCCAGGCTGGGG + Intronic
1028888536 7:95961208-95961230 TCTCTCCACTACCCATGCTGTGG - Intronic
1029095442 7:98081826-98081848 TCTCTCCGTCACCCAGGCTGGGG + Intergenic
1029242556 7:99174443-99174465 TCCCCTCACCCCCCAGCCTGTGG + Intronic
1030231733 7:107214887-107214909 TCGCTCTATCACCCAGGCTGGGG - Intronic
1030771777 7:113484444-113484466 CCACCCCACCACCCAGTCCGTGG + Intergenic
1031765126 7:125768663-125768685 TCTCTCTGTCACCCAGGCTGAGG + Intergenic
1031903187 7:127432088-127432110 TCTCTCCTCAAGCCAGGCTGGGG + Intergenic
1032127479 7:129205443-129205465 TCTTCCCACGTTCCAGGCTGAGG - Intronic
1032192424 7:129772554-129772576 ATTTCCTACCACCCAGGCTGGGG - Intergenic
1032274067 7:130439532-130439554 TCCCCCCACCCTCCAGGCTCTGG + Intronic
1032725510 7:134586875-134586897 ATTCCCCACCACCCTTGCTGGGG + Intergenic
1032727988 7:134609863-134609885 TCGCTCTACCGCCCAGGCTGGGG - Intergenic
1032829151 7:135605085-135605107 TCGCTCTATCACCCAGGCTGGGG + Intronic
1033062790 7:138124005-138124027 TCTTCCCACAAGCCAGGCTCTGG - Intergenic
1033175985 7:139124123-139124145 TCTCCCCTCCTCCCAGCCTCTGG - Intergenic
1033189809 7:139267502-139267524 TCACCCTATCACCCAGGTTGGGG - Intronic
1033286700 7:140047647-140047669 TCTCACTGTCACCCAGGCTGGGG + Intronic
1033407118 7:141080586-141080608 TCGCTCTATCACCCAGGCTGGGG - Intronic
1033657377 7:143382530-143382552 TCCCCCCACCCCCAAGGCAGAGG - Intronic
1034563013 7:151893819-151893841 CCTCCACACCACCAAGGCTGTGG + Intergenic
1034584487 7:152077057-152077079 TCTCACTGTCACCCAGGCTGGGG - Intronic
1034678230 7:152908046-152908068 TCTGCTCACCGGCCAGGCTGGGG - Intergenic
1034838343 7:154372882-154372904 CTTCCCCACCACCCAGGCTGAGG + Intronic
1035146626 7:156824056-156824078 TCTCTCTGTCACCCAGGCTGGGG - Intronic
1035171121 7:157018001-157018023 GCTCCCCTCCTCCCGGGCTGCGG - Intergenic
1035436817 7:158865641-158865663 TCACCCCAGTCCCCAGGCTGGGG + Intronic
1035628614 8:1091901-1091923 GCTCCCCACATCCCAGGCTGGGG + Intergenic
1035655824 8:1303873-1303895 TCCCTCCACCTCCCAGGCTCTGG - Intergenic
1036633209 8:10529835-10529857 TCCACCCACCCCCCAGCCTGTGG + Intronic
1036884725 8:12543554-12543576 TCTCACTCTCACCCAGGCTGGGG + Intergenic
1037346697 8:17908691-17908713 TGTCACCACCACCGCGGCTGTGG - Intronic
1037536838 8:19832536-19832558 TCTCACTGTCACCCAGGCTGGGG - Intronic
1037698350 8:21248207-21248229 TCTCCCCTCCACCCAGCCCCTGG - Intergenic
1037878441 8:22561017-22561039 TGCCCTCACCACTCAGGCTGGGG - Intronic
1038408901 8:27342963-27342985 CCTCCCCATCACCCAGGCCTTGG - Intronic
1039488556 8:37930297-37930319 TCACTCCATCACCCAGGTTGGGG - Intergenic
1041011707 8:53549874-53549896 TCTCCATACCGGCCAGGCTGGGG + Intergenic
1041269706 8:56099532-56099554 TCGCTCTGCCACCCAGGCTGGGG + Intergenic
1041459958 8:58100426-58100448 TGTCTCAACCACCCAGTCTGTGG - Intronic
1044650171 8:94485640-94485662 TCTCACTGTCACCCAGGCTGGGG - Intergenic
1047153078 8:122286298-122286320 TCCCCTCCCCACCCAGGCTTTGG - Intergenic
1048599071 8:135899758-135899780 GGTCCCCAACTCCCAGGCTGAGG + Intergenic
1049239174 8:141528208-141528230 CCTCCCCACACTCCAGGCTGGGG + Intergenic
1049298384 8:141855869-141855891 TCTGCCTTCCACCCGGGCTGAGG + Intergenic
1049361520 8:142214380-142214402 TCTCCCCGCCACCCCGGATTTGG + Intronic
1049423030 8:142525220-142525242 CCTCCCCACAGCCCTGGCTGTGG + Intronic
1049457814 8:142702732-142702754 TCTGGCCATCACCCAGGGTGTGG - Intronic
1049470933 8:142774740-142774762 TCTCCCCACCACCCCACCTGCGG + Intronic
1049537572 8:143189481-143189503 TCTCCCCACAACCTCAGCTGTGG + Intergenic
1049579431 8:143404654-143404676 GCCCCCCACCCCCCGGGCTGAGG + Intergenic
1049637669 8:143697698-143697720 CCTCCTCACCACCCAGGCGGGGG + Intronic
1049794830 8:144492365-144492387 TCTCTCTGTCACCCAGGCTGGGG + Intronic
1050253890 9:3774038-3774060 TCTAACCACCGGCCAGGCTGAGG - Intergenic
1050472539 9:6008029-6008051 TCTCCCCTCCCCCCCGGCGGCGG + Intergenic
1051233957 9:14979274-14979296 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1051646675 9:19275500-19275522 TCTCTCTTTCACCCAGGCTGAGG + Intronic
1052609800 9:30758258-30758280 GCTCCCCACCAACCATGTTGCGG - Intergenic
1052749843 9:32478589-32478611 TCACTCTACCACCCAAGCTGGGG + Intronic
1052863130 9:33448925-33448947 TTGCTCCATCACCCAGGCTGTGG + Intergenic
1053463383 9:38287875-38287897 TGTCCCCCCCAACCAGTCTGAGG - Intergenic
1053575541 9:39355503-39355525 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1053678681 9:40464679-40464701 TCTCATCACCGCTCAGGCTGTGG + Intergenic
1053791032 9:41686338-41686360 TCCGCCCACAACCCAGGCTTAGG - Intergenic
1053840046 9:42183442-42183464 CCTCCCCACCCCCAAAGCTGGGG - Intergenic
1053928666 9:43093032-43093054 TCTCATCGCCACTCAGGCTGTGG + Intergenic
1054097101 9:60914190-60914212 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1054118508 9:61189819-61189841 CCTCCCCACCCCCCAAGCTGGGG - Intergenic
1054154118 9:61628434-61628456 TCCGCCCACAACCCAGGCTTAGG + Intergenic
1054179378 9:61898032-61898054 TCCGCCCACAACCCAGGCTTAGG - Intergenic
1054285042 9:63160263-63160285 TCTCATCACCGCTCAGGCTGTGG - Intergenic
1054291759 9:63300217-63300239 TCTCATCACCGCTCAGGCTGTGG + Intergenic
1054389777 9:64604760-64604782 TCTCATCACCGCTCAGGCTGTGG + Intergenic
1054473905 9:65559554-65559576 TCCGCCCACAACCCAGGCTTAGG + Intergenic
1054505937 9:65911616-65911638 TCTCATCACCGCTCAGGCTGTGG - Intergenic
1054589249 9:66992745-66992767 CCTCCCTACCCCCCAAGCTGGGG + Intergenic
1054658160 9:67682789-67682811 TCCGCCCACAACCCAGGCTTAGG + Intergenic
1055987242 9:82063857-82063879 CCTCCCCACCCCCCAAGCTGGGG + Intergenic
1056119642 9:83474763-83474785 TCTCCCCACCACCACCACTGAGG + Intronic
1056660435 9:88539167-88539189 TCTCCCCACCTCTGACGCTGGGG - Intronic
1057000409 9:91503856-91503878 CCTACTCTCCACCCAGGCTGAGG + Intergenic
1057159933 9:92882421-92882443 CCTCCCCACCCCCCAAGCCGGGG - Intergenic
1057185051 9:93052821-93052843 TCTCCCTACAAACCAGGCTTTGG - Intergenic
1057371747 9:94480015-94480037 TCCCCCCACCACCCAGGTGCCGG - Intergenic
1057383763 9:94590447-94590469 ACACACCACCACCCAGGCAGGGG - Intronic
1058203556 9:102073452-102073474 TCTCTCTGTCACCCAGGCTGGGG + Intergenic
1058946509 9:109862133-109862155 TCTTCCCTCCCCACAGGCTGTGG - Intronic
1059142013 9:111862287-111862309 TCACTCTATCACCCAGGCTGGGG - Intergenic
1059289315 9:113208303-113208325 TCATTCCATCACCCAGGCTGGGG - Intronic
1059309154 9:113376733-113376755 TCTCCCCACCTCCAGGGCTCGGG + Intronic
1060059686 9:120448039-120448061 TCTCCCTGCCACCCAGGAGGTGG - Exonic
1060727306 9:126015013-126015035 TCTCCCCAGCTCCCTGGCTCGGG - Intergenic
1061205890 9:129163155-129163177 TCTCCCTGTCACTCAGGCTGGGG + Intergenic
1061370022 9:130192876-130192898 CCTCCCCACCTCCCAGTGTGCGG + Intronic
1061484736 9:130914531-130914553 TCTCCCCACTACCCGCACTGTGG - Intronic
1061925884 9:133805895-133805917 CCTCTCCATCAACCAGGCTGCGG + Intronic
1061962125 9:133993509-133993531 CGCCCCCACCACCCAGGGTGTGG - Intergenic
1062026483 9:134342980-134343002 TCCCCCCACTGCCTAGGCTGCGG - Intronic
1062030099 9:134358359-134358381 GCTCCACCCTACCCAGGCTGAGG - Intronic
1062329466 9:136031367-136031389 TTGCTCCATCACCCAGGCTGGGG + Intronic
1062396242 9:136353968-136353990 TCTCCCCTCCCTCCTGGCTGGGG + Intronic
1062430247 9:136523682-136523704 TCTGCCCACCCCTCAGGCTGTGG + Intronic
1062457404 9:136646144-136646166 TCTGCCGTCCACCCAGGCTCTGG - Intergenic
1062459490 9:136656933-136656955 TCTCCCCACCTGCCCGCCTGGGG - Intergenic
1062506395 9:136879649-136879671 TTTGCTCGCCACCCAGGCTGGGG + Intronic
1062530478 9:136997355-136997377 TCTTCCAGCCACGCAGGCTGTGG - Intergenic
1185599616 X:1329907-1329929 TCCAGCCATCACCCAGGCTGCGG + Intergenic
1185747202 X:2583294-2583316 TCCCCCCACCCCCAAGGCTTCGG + Intergenic
1185910968 X:3980869-3980891 TCACTCTATCACCCAGGCTGGGG - Intergenic
1186848339 X:13553882-13553904 TCTCCCCAACACTCAGGCTGAGG - Intergenic
1187877924 X:23819424-23819446 TCCCTCTGCCACCCAGGCTGGGG - Intergenic
1188209726 X:27407575-27407597 TCACTCCATCCCCCAGGCTGCGG + Intergenic
1189691680 X:43623682-43623704 TCTCGCTGTCACCCAGGCTGGGG + Intergenic
1190280738 X:48927780-48927802 TCTCCCCTCCCCAAAGGCTGGGG + Intronic
1190379052 X:49820299-49820321 TCTCCCTACTCCCCAGTCTGTGG + Intergenic
1190413604 X:50160654-50160676 TCACCCTGTCACCCAGGCTGGGG - Intergenic
1190890899 X:54566803-54566825 TCTCACTGTCACCCAGGCTGGGG + Intergenic
1191942785 X:66498847-66498869 GCTCCACCCCACCCAGGGTGAGG + Intergenic
1192493399 X:71596182-71596204 TCTCACTCCCACCCAGGCTGGGG - Intronic
1192806500 X:74514464-74514486 CCTCCCCGCCTCCCATGCTGAGG + Intronic
1193427235 X:81354875-81354897 TATCCCCACCCCACTGGCTGAGG + Intergenic
1194608937 X:96016839-96016861 TTTTCCCACCCCCCAGCCTGTGG - Intergenic
1196184176 X:112727416-112727438 TCGCTCTGCCACCCAGGCTGGGG - Intergenic
1196441516 X:115723482-115723504 TCTCCCCACCTACATGGCTGAGG + Intergenic
1196445046 X:115841471-115841493 TCTCCCCACCTACATGGCTGAGG + Intergenic
1196842322 X:119870177-119870199 TCTCCCCAACACCTTGGCTCGGG + Intergenic
1197895936 X:131315456-131315478 TCACTCCACCACCAAGGCTTTGG - Intronic
1198089915 X:133318421-133318443 TCTCCCCACCTCCCAGGTTAAGG - Intronic
1198090198 X:133321229-133321251 TCTCCCTACCTCCCAGGTTACGG - Intronic
1199389649 X:147264138-147264160 GGTCCCCAACCCCCAGGCTGTGG + Intergenic
1199440094 X:147857994-147858016 TGTCCCCAACCCCCAGGCTATGG + Intergenic
1200131415 X:153849898-153849920 TCTCTCTGCCGCCCAGGCTGAGG + Intergenic
1200136398 X:153876965-153876987 TCACTCCATCACCCAGGCTGGGG - Intronic
1201246007 Y:12004390-12004412 TTTCTCTATCACCCAGGCTGGGG - Intergenic
1201539350 Y:15089539-15089561 TGTCCCTAACACACAGGCTGTGG + Intergenic
1202603400 Y:26617846-26617868 TCACTCTGCCACCCAGGCTGGGG - Intergenic