ID: 1122084275

View in Genome Browser
Species Human (GRCh38)
Location 14:99289047-99289069
Sequence TTGAGGCAGTTAAGAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122084275_1122084279 18 Left 1122084275 14:99289047-99289069 CCACTGGCTCTTAACTGCCTCAA No data
Right 1122084279 14:99289088-99289110 CACCTCTATTCACAGCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122084275 Original CRISPR TTGAGGCAGTTAAGAGCCAG TGG (reversed) Intergenic
No off target data available for this crispr