ID: 1122087006

View in Genome Browser
Species Human (GRCh38)
Location 14:99314771-99314793
Sequence CATGCTAGGTGGGCTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122087006_1122087011 -9 Left 1122087006 14:99314771-99314793 CCTCTCCAAGCCCACCTAGCATG No data
Right 1122087011 14:99314785-99314807 CCTAGCATGCATCTTCATGACGG No data
1122087006_1122087012 -6 Left 1122087006 14:99314771-99314793 CCTCTCCAAGCCCACCTAGCATG No data
Right 1122087012 14:99314788-99314810 AGCATGCATCTTCATGACGGTGG No data
1122087006_1122087013 -5 Left 1122087006 14:99314771-99314793 CCTCTCCAAGCCCACCTAGCATG No data
Right 1122087013 14:99314789-99314811 GCATGCATCTTCATGACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122087006 Original CRISPR CATGCTAGGTGGGCTTGGAG AGG (reversed) Intergenic
No off target data available for this crispr