ID: 1122087012

View in Genome Browser
Species Human (GRCh38)
Location 14:99314788-99314810
Sequence AGCATGCATCTTCATGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122087004_1122087012 15 Left 1122087004 14:99314750-99314772 CCACTAAAGGTGTGAGGCCAACC No data
Right 1122087012 14:99314788-99314810 AGCATGCATCTTCATGACGGTGG No data
1122087005_1122087012 -2 Left 1122087005 14:99314767-99314789 CCAACCTCTCCAAGCCCACCTAG No data
Right 1122087012 14:99314788-99314810 AGCATGCATCTTCATGACGGTGG No data
1122087002_1122087012 24 Left 1122087002 14:99314741-99314763 CCTGGAGCTCCACTAAAGGTGTG No data
Right 1122087012 14:99314788-99314810 AGCATGCATCTTCATGACGGTGG No data
1122087006_1122087012 -6 Left 1122087006 14:99314771-99314793 CCTCTCCAAGCCCACCTAGCATG No data
Right 1122087012 14:99314788-99314810 AGCATGCATCTTCATGACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122087012 Original CRISPR AGCATGCATCTTCATGACGG TGG Intergenic
No off target data available for this crispr