ID: 1122088779

View in Genome Browser
Species Human (GRCh38)
Location 14:99324390-99324412
Sequence TCGTCCAACACAGAATCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122088779_1122088791 26 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088791 14:99324439-99324461 TGGTCGGGGAGCAGCCACCCAGG No data
1122088779_1122088785 10 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088785 14:99324423-99324445 GCCTGCCCACTGGAGCTGGTCGG No data
1122088779_1122088783 6 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088783 14:99324419-99324441 CCCAGCCTGCCCACTGGAGCTGG No data
1122088779_1122088781 0 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088781 14:99324413-99324435 GGCAGACCCAGCCTGCCCACTGG No data
1122088779_1122088788 12 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088788 14:99324425-99324447 CTGCCCACTGGAGCTGGTCGGGG No data
1122088779_1122088787 11 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088787 14:99324424-99324446 CCTGCCCACTGGAGCTGGTCGGG No data
1122088779_1122088792 27 Left 1122088779 14:99324390-99324412 CCTGGTGATTCTGTGTTGGACGA No data
Right 1122088792 14:99324440-99324462 GGTCGGGGAGCAGCCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122088779 Original CRISPR TCGTCCAACACAGAATCACC AGG (reversed) Intergenic
No off target data available for this crispr