ID: 1122091006

View in Genome Browser
Species Human (GRCh38)
Location 14:99340524-99340546
Sequence TGAGTGTCGTGCTAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122091006_1122091014 26 Left 1122091006 14:99340524-99340546 CCTTCACTCTAGCACGACACTCA No data
Right 1122091014 14:99340573-99340595 CTAAACTACAAAACCTGGATGGG No data
1122091006_1122091013 25 Left 1122091006 14:99340524-99340546 CCTTCACTCTAGCACGACACTCA No data
Right 1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG No data
1122091006_1122091010 21 Left 1122091006 14:99340524-99340546 CCTTCACTCTAGCACGACACTCA No data
Right 1122091010 14:99340568-99340590 ATACCCTAAACTACAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122091006 Original CRISPR TGAGTGTCGTGCTAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr